Transcript: Human XM_017007511.1

PREDICTED: Homo sapiens 2-phosphoxylose phosphatase 1 (PXYLP1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PXYLP1 (92370)
Length:
3287
CDS:
517..1845

Additional Resources:

NCBI RefSeq record:
XM_017007511.1
NBCI Gene record:
PXYLP1 (92370)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017007511.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000052900 CCCGGTAAGAAACCAGTATCT pLKO.1 1143 CDS 100% 4.950 6.930 N PXYLP1 n/a
2 TRCN0000307796 CCCGGTAAGAAACCAGTATCT pLKO_005 1143 CDS 100% 4.950 6.930 N PXYLP1 n/a
3 TRCN0000052902 GTAGCAAGAGTCGAAAGAGAA pLKO.1 521 CDS 100% 4.950 6.930 N PXYLP1 n/a
4 TRCN0000307799 GTAGCAAGAGTCGAAAGAGAA pLKO_005 521 CDS 100% 4.950 6.930 N PXYLP1 n/a
5 TRCN0000303369 TACTAAGGGTAGAAGATTATT pLKO_005 1922 3UTR 100% 15.000 10.500 N PXYLP1 n/a
6 TRCN0000380131 AGAGGAATAGAAGGTACTTTA pLKO_005 2056 3UTR 100% 13.200 9.240 N PXYLP1 n/a
7 TRCN0000052898 CCACTGTATGTCATTCCCAAA pLKO.1 706 CDS 100% 4.050 2.835 N PXYLP1 n/a
8 TRCN0000291898 CCACTGTATGTCATTCCCAAA pLKO_005 706 CDS 100% 4.050 2.835 N PXYLP1 n/a
9 TRCN0000052899 GCCAGGTTGATCTTTGAGCTT pLKO.1 1603 CDS 100% 2.640 1.848 N PXYLP1 n/a
10 TRCN0000052901 GAAGAAATTGTACTTCGGGTA pLKO.1 1413 CDS 100% 2.160 1.512 N PXYLP1 n/a
11 TRCN0000291897 GAAGAAATTGTACTTCGGGTA pLKO_005 1413 CDS 100% 2.160 1.512 N PXYLP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017007511.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09340 pDONR223 100% 91.9% 92% None 0_1ins114;102C>T;912C>T n/a
2 ccsbBroad304_09340 pLX_304 0% 91.9% 92% V5 0_1ins114;102C>T;912C>T n/a
3 TRCN0000477458 TTGTCATACCGCACTTCGCCCATC pLX_317 24.5% 91.9% 92% V5 0_1ins114;102C>T;912C>T n/a
Download CSV