Transcript: Mouse NM_001289645.1

Mus musculus 2-phosphoxylose phosphatase 1 (Pxylp1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Pxylp1 (235534)
Length:
3190
CDS:
406..1848

Additional Resources:

NCBI RefSeq record:
NM_001289645.1
NBCI Gene record:
Pxylp1 (235534)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001289645.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000080943 CCGTAGTCTATTGGCTGCATA pLKO.1 2651 3UTR 100% 4.950 6.930 N Pxylp1 n/a
2 TRCN0000324813 CCGTAGTCTATTGGCTGCATA pLKO_005 2651 3UTR 100% 4.950 6.930 N Pxylp1 n/a
3 TRCN0000080947 CAGTGAACATTCGGTCCGAAT pLKO.1 1647 CDS 100% 4.050 5.670 N Pxylp1 n/a
4 TRCN0000080944 CCGCTTTGTCAAACGGGATAT pLKO.1 1764 CDS 100% 10.800 8.640 N Pxylp1 n/a
5 TRCN0000305851 TGATCAAGACGCACCAGATAG pLKO_005 1373 CDS 100% 10.800 8.640 N Pxylp1 n/a
6 TRCN0000305852 CTGGATGGCAGTAGTACTAAC pLKO_005 1795 CDS 100% 10.800 7.560 N Pxylp1 n/a
7 TRCN0000080945 GCTCTTCTGTACTGCAACATT pLKO.1 595 CDS 100% 5.625 3.938 N Pxylp1 n/a
8 TRCN0000324814 GCTCTTCTGTACTGCAACATT pLKO_005 595 CDS 100% 5.625 3.938 N Pxylp1 n/a
9 TRCN0000080946 CGTTTGAAGAACAGCGACCTA pLKO.1 1198 CDS 100% 2.640 1.848 N Pxylp1 n/a
10 TRCN0000324812 CGTTTGAAGAACAGCGACCTA pLKO_005 1198 CDS 100% 2.640 1.848 N Pxylp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001289645.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09340 pDONR223 100% 84.5% 89.1% None (many diffs) n/a
2 ccsbBroad304_09340 pLX_304 0% 84.5% 89.1% V5 (many diffs) n/a
3 TRCN0000477458 TTGTCATACCGCACTTCGCCCATC pLX_317 24.5% 84.5% 89.1% V5 (many diffs) n/a
Download CSV