Construct: ORF TRCN0000477484
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF007528.1_s317c1
- Derived from:
- ccsbBroadEn_05730
- DNA Barcode:
- GGCCATAGCACGCACAAACGTCAA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- LRTM2 (654429)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000477484
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 654429 | LRTM2 | leucine rich repeats and tr... | NM_001039029.3 | 100% | 100% | |
| 2 | human | 654429 | LRTM2 | leucine rich repeats and tr... | NM_001163925.1 | 100% | 100% | |
| 3 | human | 654429 | LRTM2 | leucine rich repeats and tr... | NM_001163926.2 | 100% | 100% | |
| 4 | human | 654429 | LRTM2 | leucine rich repeats and tr... | XM_011521015.1 | 100% | 100% | |
| 5 | human | 654429 | LRTM2 | leucine rich repeats and tr... | XM_017019848.1 | 86.6% | 86.6% | 1_171del |
| 6 | mouse | 211187 | Lrtm2 | leucine-rich repeats and tr... | NM_001172207.1 | 86.1% | 92.1% | (many diffs) |
| 7 | mouse | 211187 | Lrtm2 | leucine-rich repeats and tr... | NM_172492.3 | 86.1% | 92.1% | (many diffs) |
| 8 | mouse | 211187 | Lrtm2 | leucine-rich repeats and tr... | XM_006505849.3 | 86.1% | 92.1% | (many diffs) |
| 9 | mouse | 211187 | Lrtm2 | leucine-rich repeats and tr... | XM_011241276.2 | 86.1% | 92.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1179
- ORF length:
- 1110
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gctggcgccg ggcagcagcc ctgggcagag gggcaggctc gccctgcagt 121 ggaggcaagt ctcctggatc acctgctgga tcgccctgta tgctgtggag gccctcccca 181 cctgcccttt ctcctgcaag tgtgacagcc gcagcctgga ggtggactgc agtggccttg 241 gcctcaccac ggtgccccca gacgtgcccg cagccacccg aaccctcttg ctcttgaaca 301 ataagctgag tgccctgcca agctgggctt tcgccaacct ctccagcctg cagcggttgg 361 acctgtccaa caacttcctg gaccggctgc cccgctccat tttcggggac ctgacgaatc 421 tgactgagct tcagctgcgc aataacagca tcaggaccct ggacagggac ctgctgcggc 481 actcgccgct gctccgccac ctggacctgt ccatcaacgg cctggcccag ttgccccctg 541 gtcttttcga cgggctcctg gctctgcgct ccctctcgct tcgctccaac cgtctgcaga 601 atctggaccg gctgacattt gaacccctag caaacctgca gctgctgcag gtcggggata 661 acccctggga gtgtgactgt aacctgcgtg agttcaaaca ctggatggag tggttctcct 721 accgaggggg acgcttggac cagcttgcct gcaccctgcc caaggagctg agggggAAGG 781 ACATGCGGAT GGTCCCCATG GAGATGTTCA ACTACTGCTC CCAGCTGGAG GACGAGAATA 841 GCTCAGCTGG GCTGGATATT CCTGGGCCAC CCTGCACCAA GGCCAGTCCA GAGCCTGCTA 901 AGCCCAAGCC CGGGGCTGAG CCGGAGCCGG AGCCCAGCAC AGCCTGCCCA CAGAAGCAGA 961 GGCACCGGCC GGCGAGCGTG AGGCGAGCCA TGGGCACGGT GATCATTGCA GGGGTCGTGT 1021 GCGGCGTCGT CTGCATCATG ATGGTGGTGG CCGCTGCCTA TGGCTGCATC TACGCCTCCC 1081 TCATGGCCAA GTACCACCGG GAGCTCAAAA AGCGCCAGCC CCTGATGGGG GACCCCGAGG 1141 GCGAGCACGA GGACCAGAAG CAGATCTCTT CTGTGGCCTT GCCAACTTTC TTGTACAAAG 1201 TGGTTGATAT CGGTAAGCCT ATCCCTAACC CTCTCCTCGG TCTCGATTCT ACGTAGTAAT 1261 GAACTAGTCC GTAACTTGAA AGTATTTCGA TTTCTTGGCT TTATATATCT TGTGGAAAGG 1321 ACGAGGCCAT AGCACGCACA AACGTCAAAC GCGTTAAGTC gacaatcaac ctctggatta 1381 caaaatttgt gaaagatt