Transcript: Mouse XM_011241276.2

PREDICTED: Mus musculus leucine-rich repeats and transmembrane domains 2 (Lrtm2), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Lrtm2 (211187)
Length:
3830
CDS:
795..1907

Additional Resources:

NCBI RefSeq record:
XM_011241276.2
NBCI Gene record:
Lrtm2 (211187)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011241276.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000176641 CACTACTTAGACATCTGGATT pLKO.1 1213 CDS 100% 4.950 3.960 N Lrtm2 n/a
2 TRCN0000197965 GATGTCATTATGTCCCTTTAT pLKO.1 2464 3UTR 100% 13.200 9.240 N Lrtm2 n/a
3 TRCN0000181691 CCAGCTCTTAGCCAATGTGAA pLKO.1 2372 3UTR 100% 4.950 3.465 N Lrtm2 n/a
4 TRCN0000181228 CTGCATCTACGCATCTCTCAT pLKO.1 1790 CDS 100% 4.950 3.465 N Lrtm2 n/a
5 TRCN0000181711 GATCAGAAGCAGATCTCGTCT pLKO.1 1878 CDS 100% 2.640 1.848 N Lrtm2 n/a
6 TRCN0000177299 GATGTTTAACTACTGTTCCCA pLKO.1 1529 CDS 100% 0.750 0.525 N Lrtm2 n/a
7 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2616 3UTR 100% 4.950 2.475 Y KAAG1 n/a
8 TRCN0000172440 CACACACACACACACAGACAA pLKO.1 2626 3UTR 100% 4.950 2.475 Y LINC00955 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011241276.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05730 pDONR223 100% 86.1% 92.1% None (many diffs) n/a
2 ccsbBroad304_05730 pLX_304 0% 86.1% 92.1% V5 (many diffs) n/a
3 TRCN0000477484 GGCCATAGCACGCACAAACGTCAA pLX_317 36.4% 86.1% 92.1% V5 (many diffs) n/a
Download CSV