Transcript: Human XM_017019848.1

PREDICTED: Homo sapiens leucine rich repeats and transmembrane domains 2 (LRTM2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LRTM2 (654429)
Length:
3359
CDS:
44..1327

Additional Resources:

NCBI RefSeq record:
XM_017019848.1
NBCI Gene record:
LRTM2 (654429)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017019848.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000256565 TGAGCTTCAGCTGCGCAATAA pLKO_005 571 CDS 100% 13.200 18.480 N LRTM2 n/a
2 TRCN0000256562 AGCTCAGCTGGGCTGGATATT pLKO_005 986 CDS 100% 13.200 9.240 N LRTM2 n/a
3 TRCN0000256564 ATGCTCCTGGATTCGCTAATT pLKO_005 1954 3UTR 100% 13.200 9.240 N LRTM2 n/a
4 TRCN0000256566 ATCTGGACCGGCTGACATTTG pLKO_005 747 CDS 100% 10.800 7.560 N LRTM2 n/a
5 TRCN0000256563 GTAACCTGCGTGAGTTCAAAC pLKO_005 825 CDS 100% 10.800 7.560 N LRTM2 n/a
6 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2030 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017019848.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05730 pDONR223 100% 86.6% 86.6% None 1_171del n/a
2 ccsbBroad304_05730 pLX_304 0% 86.6% 86.6% V5 1_171del n/a
3 TRCN0000477484 GGCCATAGCACGCACAAACGTCAA pLX_317 36.4% 86.6% 86.6% V5 1_171del n/a
Download CSV