Construct: ORF TRCN0000477501
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF007837.1_s317c1
- Derived from:
- ccsbBroadEn_05090
- DNA Barcode:
- GACCAGTGTGACACATGAGACCCT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- ANKRD46 (157567)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000477501
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 157567 | ANKRD46 | ankyrin repeat domain 46 | NM_001270377.2 | 100% | 100% | |
| 2 | human | 157567 | ANKRD46 | ankyrin repeat domain 46 | NM_001270378.2 | 100% | 100% | |
| 3 | human | 157567 | ANKRD46 | ankyrin repeat domain 46 | NM_198401.4 | 100% | 100% | |
| 4 | human | 157567 | ANKRD46 | ankyrin repeat domain 46 | NM_001270379.2 | 94.1% | 86.8% | (many diffs) |
| 5 | mouse | 68839 | Ankrd46 | ankyrin repeat domain 46 | NM_001358006.1 | 87.7% | 97.8% | (many diffs) |
| 6 | mouse | 68839 | Ankrd46 | ankyrin repeat domain 46 | NM_001358007.1 | 87.7% | 97.8% | (many diffs) |
| 7 | mouse | 68839 | Ankrd46 | ankyrin repeat domain 46 | NM_175134.4 | 87.7% | 97.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 750
- ORF length:
- 684
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtc gtatgttttt gtaaatgatt cttctcagac taacgtgccc ttgctgcaag 121 cctgtattga tggggacttt aattattcca agcggctttt ggaaagtggc tttgacccaa 181 atattcgtga cagcaggggc agaacaggcc ttcaccttgc agcagctcga gggaatgtag 241 acatctgcca gttactgcat aaattcggtg ccgatcttct ggccacagat tatcaaggaa 301 acacagctct tcacctctgt ggccatgtgg atactatcca atttttggtt tccaatggac 361 tcaaaattga tatttgcaat catcaaggtg ctaccccttt agttctggca aagcgcagag 421 gagtaaataa agatgtcatc cgattgctgg aatctttGGA AGAACAGGAG GTGAAAGGAT 481 TTAACAGAGG AACCCACTCG AAACTGGAGA CCATGCAAAC AGCTGAGAGT GAAAGTGCCA 541 TGGAAAGCCA TTCACTCCTC AATCCCAACC TGCAGCAAGG TGAAGGAGTC CTCTCCAGCT 601 TCCGAACCAC GTGGCAGGAG TTTGTGGAGG ATCTGGGCTT CTGGAGAGTA TTGCTGTTGA 661 TCTTCGTCAT TGCTTTGCTG TCTCTTGGCA TTGCTTATTA TGTGAGTGGG GTGCTACCCT 721 TCGTGGAAAA CCAGCCTGAA CTGGTGCATT ACCCAACTTT CTTGTACAAA GTGGTTGATA 781 TCGGTAAGCC TATCCCTAAC CCTCTCCTCG GTCTCGATTC TACGTAGTAA TGAACTAGTC 841 CGTAACTTGA AAGTATTTCG ATTTCTTGGC TTTATATATC TTGTGGAAAG GACGAGACCA 901 GTGTGACACA TGAGACCCTA CGCGTTAAGT Cgacaatcaa cctctggatt acaaaatttg 961 tgaaagatt