Transcript: Mouse NM_001358007.1

Mus musculus ankyrin repeat domain 46 (Ankrd46), transcript variant 1, mRNA.

Source:
NCBI, updated 2018-09-30
Taxon:
Mus musculus (mouse)
Gene:
Ankrd46 (68839)
Length:
2810
CDS:
535..1221

Additional Resources:

NCBI RefSeq record:
NM_001358007.1
NBCI Gene record:
Ankrd46 (68839)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001358007.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000216157 CAGGAAGTAAAGGGATTTAAC pLKO.1 934 CDS 100% 13.200 10.560 N Ankrd46 n/a
2 TRCN0000241146 CTTTGTAGTGAATAGTCATTA pLKO_005 1951 3UTR 100% 13.200 9.240 N Ankrd46 n/a
3 TRCN0000241145 ATCCGACTGCTGGAGTCTTTG pLKO_005 907 CDS 100% 10.800 7.560 N Ankrd46 n/a
4 TRCN0000241144 ATCTGCCAGCTGCTGCATAAG pLKO_005 712 CDS 100% 10.800 7.560 N Ankrd46 n/a
5 TRCN0000241143 GTGTTGCCCTTTGTGGATAAC pLKO_005 1180 CDS 100% 10.800 7.560 N Ankrd46 n/a
6 TRCN0000241142 TGGACACCATTCAGTTCTTAG pLKO_005 797 CDS 100% 10.800 7.560 N Ankrd46 n/a
7 TRCN0000184050 CCCTCTTTGCTTCTGTGGTAT pLKO.1 2261 3UTR 100% 4.950 3.465 N Ankrd46 n/a
8 TRCN0000216329 GTTGATCTTGGTCATTGCTTT pLKO.1 1125 CDS 100% 4.950 3.465 N Ankrd46 n/a
9 TRCN0000129466 GAAAGTGCCATGGAAAGCCAT pLKO.1 1000 CDS 100% 2.640 1.848 N ANKRD46 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001358007.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05090 pDONR223 100% 87.7% 97.8% None (many diffs) n/a
2 ccsbBroad304_05090 pLX_304 0% 87.7% 97.8% V5 (many diffs) n/a
3 TRCN0000477501 GACCAGTGTGACACATGAGACCCT pLX_317 43% 87.7% 97.8% V5 (many diffs) n/a
Download CSV