Transcript: Human NM_198401.4

Homo sapiens ankyrin repeat domain 46 (ANKRD46), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
ANKRD46 (157567)
Length:
2754
CDS:
285..971

Additional Resources:

NCBI RefSeq record:
NM_198401.4
NBCI Gene record:
ANKRD46 (157567)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_198401.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000128774 CTTCTGGAGAGTATTGCTGTT pLKO.1 857 CDS 100% 4.050 3.240 N ANKRD46 n/a
2 TRCN0000426997 ATGGAAGATGAGGCAATTAAT pLKO_005 980 3UTR 100% 15.000 10.500 N ANKRD46 n/a
3 TRCN0000432940 GCAAAGCGCAGAGGAGTAAAT pLKO_005 627 CDS 100% 13.200 9.240 N ANKRD46 n/a
4 TRCN0000128918 GCCACAGATTATCAAGGAAAC pLKO.1 501 CDS 100% 6.000 4.200 N ANKRD46 n/a
5 TRCN0000129558 CGAAACTGGAGACCATGCAAA pLKO.1 718 CDS 100% 4.950 3.465 N ANKRD46 n/a
6 TRCN0000129466 GAAAGTGCCATGGAAAGCCAT pLKO.1 750 CDS 100% 2.640 1.848 N ANKRD46 n/a
7 TRCN0000430569 GAAAGTGGCTTTGACCCAAAT pLKO_005 381 CDS 100% 10.800 6.480 N ANKRD46 n/a
8 TRCN0000128919 GAAAGCCATTCACTCCTCAAT pLKO.1 762 CDS 100% 4.950 2.970 N ANKRD46 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_198401.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05090 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05090 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000477501 GACCAGTGTGACACATGAGACCCT pLX_317 43% 100% 100% V5 n/a
Download CSV