Construct: ORF TRCN0000477545
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF007031.1_s317c1
- Derived from:
- ccsbBroadEn_01340
- DNA Barcode:
- GTAAGACCTTTGATCCCACTCCAG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PTPN2 (5771)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000477545
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 5771 | PTPN2 | protein tyrosine phosphatas... | NM_080422.2 | 100% | 100% | |
| 2 | human | 5771 | PTPN2 | protein tyrosine phosphatas... | XM_017025884.1 | 96.5% | 95.9% | (many diffs) |
| 3 | human | 5771 | PTPN2 | protein tyrosine phosphatas... | NM_001207013.1 | 94.3% | 94.3% | 496_564del |
| 4 | human | 5771 | PTPN2 | protein tyrosine phosphatas... | NM_002828.4 | 92.8% | 92.5% | (many diffs) |
| 5 | human | 5771 | PTPN2 | protein tyrosine phosphatas... | XM_005258125.4 | 91.2% | 90.7% | (many diffs) |
| 6 | human | 5771 | PTPN2 | protein tyrosine phosphatas... | NM_080423.2 | 91.2% | 91.2% | 1038_1039ins102 |
| 7 | human | 5771 | PTPN2 | protein tyrosine phosphatas... | XM_024451228.1 | 88.3% | 88.3% | 360_361ins135 |
| 8 | human | 5771 | PTPN2 | protein tyrosine phosphatas... | XM_005258124.4 | 87.9% | 87.6% | (many diffs) |
| 9 | human | 5771 | PTPN2 | protein tyrosine phosphatas... | NM_001308287.1 | 83.4% | 78.2% | (many diffs) |
| 10 | human | 5771 | PTPN2 | protein tyrosine phosphatas... | XM_017025885.2 | 83.4% | 78.2% | (many diffs) |
| 11 | human | 5771 | PTPN2 | protein tyrosine phosphatas... | XM_011525706.2 | 82% | 81.6% | (many diffs) |
| 12 | human | 5771 | PTPN2 | protein tyrosine phosphatas... | XM_011525705.3 | 79.1% | 74.2% | (many diffs) |
| 13 | human | 5771 | PTPN2 | protein tyrosine phosphatas... | XM_017025888.2 | 74.4% | 74.4% | 0_1ins297 |
| 14 | human | 5771 | PTPN2 | protein tyrosine phosphatas... | XM_017025887.2 | 71.6% | 71% | (many diffs) |
| 15 | human | 5771 | PTPN2 | protein tyrosine phosphatas... | XM_017025886.1 | 68.9% | 68.6% | (many diffs) |
| 16 | human | 5771 | PTPN2 | protein tyrosine phosphatas... | XM_024451229.1 | 68.9% | 68.6% | (many diffs) |
| 17 | human | 5771 | PTPN2 | protein tyrosine phosphatas... | XM_024451230.1 | 68.9% | 68.6% | (many diffs) |
| 18 | human | 5771 | PTPN2 | protein tyrosine phosphatas... | XM_011525707.2 | 54.7% | 52.8% | (many diffs) |
| 19 | mouse | 19255 | Ptpn2 | protein tyrosine phosphatas... | NM_008977.3 | 87.5% | 89.9% | (many diffs) |
| 20 | mouse | 19255 | Ptpn2 | protein tyrosine phosphatas... | XM_011246858.2 | 87.5% | 89.9% | (many diffs) |
| 21 | mouse | 19255 | Ptpn2 | protein tyrosine phosphatas... | NM_001127177.1 | 82% | 83.9% | (many diffs) |
| 22 | mouse | 19255 | Ptpn2 | protein tyrosine phosphatas... | XM_006525723.1 | 63.8% | 65.8% | (many diffs) |
| 23 | mouse | 19255 | Ptpn2 | protein tyrosine phosphatas... | XM_011246859.1 | 63.8% | 65.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1227
- ORF length:
- 1161
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgcc caccaccatc gagcgggagt tcgaagagtt ggatactcag cgtcgctggc 121 agccgctgta cttggaaatt cgaaatgagt cccatgacta tcctcataga gtggccaagt 181 ttccagaaaa cagaaatcga aacagataca gagatgtaag cccatatgat cacagtcgtg 241 ttaaactgca aaatgctgag aatgattata ttaatgccag tttagttgac atagaagagg 301 cacaaaggag ttacatctta acacagggtc cacttcctaa cacatgctgc catttctggc 361 ttatggtttg gcagcagaag accaaagcag ttgtcatgct gaaccgcatt gtggagaaag 421 aatcggttaa atgtgcacag tactggccaa cagatgacca agagatgctg tttaaagaaa 481 caggattcag tgtgaagctc ttgtcagaag atgtgaagtc gtattataca gtacatctac 541 tacaattaga aaatatcaat agtggtgaaa ccagaacaat atctcacttt cattatacta 601 cctggccaga ttttggagtc cctgaatcac cagcttcatt tctcaatttc ttgtttaaag 661 tgagagaatc tggctccttg aaccctgacc atgggcctgc ggtgatccac tgtagtgcag 721 gcattgggcg ctctggcacc ttctctcTGG TAGACACTTG TCTTGTTTTG ATGGAAAAAG 781 GAGATGATAT TAACATAAAA CAAGTGTTAC TGAACATGAG AAAATACCGA ATGGGTCTTA 841 TTCAGACCCC AGATCAACTG AGATTCTCAT ACATGGCTAT AATAGAAGGA GCAAAATGTA 901 TAAAGGGAGA TTCTAGTATA CAGAAACGAT GGAAAGAACT TTCTAAGGAA GACTTATCTC 961 CTGCCTTTGA TCATTCACCA AACAAAATAA TGACTGAAAA ATACAATGGG AACAGAATAG 1021 GTCTAGAAGA AGAAAAACTG ACAGGTGACC GATGTACAGG ACTTTCCTCT AAAATGCAAG 1081 ATACAATGGA GGAGAACAGT GAGAGTGCTC TACGGAAACG TATTCGAGAG GACAGAAAGG 1141 CCACCACAGC TCAGAAGGTG CAGCAGATGA AACAGAGGCT AAATGAGAAT GAACGAAAAA 1201 GAAAAAGGCC AAGATTGACA GACACCTACC CAACTTTCTT GTACAAAGTG GTTGATATCG 1261 GTAAGCCTAT CCCTAACCCT CTCCTCGGTC TCGATTCTAC GTAGTAATGA ACTAGTCCGT 1321 AACTTGAAAG TATTTCGATT TCTTGGCTTT ATATATCTTG TGGAAAGGAC GAGTAAGACC 1381 TTTGATCCCA CTCCAGACGC GTTAAGTCga caatcaacct ctggattaca aaatttgtga 1441 aagatt