Transcript: Human NM_080423.2

Homo sapiens protein tyrosine phosphatase non-receptor type 2 (PTPN2), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-07-05
Taxon:
Homo sapiens (human)
Gene:
PTPN2 (5771)
Length:
1619
CDS:
195..1256

Additional Resources:

NCBI RefSeq record:
NM_080423.2
NBCI Gene record:
PTPN2 (5771)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_080423.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000279329 ATATGATCACAGTCGTGTTAA pLKO_005 353 CDS 100% 13.200 18.480 N Ptpn2 n/a
2 TRCN0000314693 TATGATCACAGTCGTGTTAAA pLKO_005 354 CDS 100% 13.200 18.480 N PTPN2 n/a
3 TRCN0000314692 ATTCTCATACATGGCTATAAT pLKO_005 992 CDS 100% 15.000 12.000 N PTPN2 n/a
4 TRCN0000002783 GAAGATGTGAAGTCGTATTAT pLKO.1 636 CDS 100% 15.000 10.500 N PTPN2 n/a
5 TRCN0000314609 AGAAGATGTGAAGTCGTATTA pLKO_005 635 CDS 100% 13.200 9.240 N PTPN2 n/a
6 TRCN0000314612 GTGGAGAAAGAATCGGTTAAA pLKO_005 540 CDS 100% 13.200 9.240 N PTPN2 n/a
7 TRCN0000002781 GATGACCAAGAGATGCTGTTT pLKO.1 582 CDS 100% 4.950 3.465 N PTPN2 n/a
8 TRCN0000002785 CTCACTTTCATTATACTACCT pLKO.1 712 CDS 100% 2.640 1.848 N PTPN2 n/a
9 TRCN0000029891 GCCAAGATTGACAGACACCTA pLKO.1 1235 CDS 100% 2.640 1.848 N Ptpn2 n/a
10 TRCN0000002782 TGCAAGATACAATGGAGGAGA pLKO.1 1204 CDS 100% 2.640 1.584 N PTPN2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_080423.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15554 pDONR223 0% 100% 100% None n/a
2 ccsbBroad304_15554 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000469804 TACTAGGCCGCAATTGCTATCCCG pLX_317 40.5% 100% 100% V5 n/a
4 ccsbBroadEn_01340 pDONR223 100% 91.2% 91.2% None 1038_1039ins102 n/a
5 ccsbBroad304_01340 pLX_304 0% 91.2% 91.2% V5 1038_1039ins102 n/a
6 TRCN0000477545 GTAAGACCTTTGATCCCACTCCAG pLX_317 41.4% 91.2% 91.2% V5 1038_1039ins102 n/a
Download CSV