Transcript: Human XM_017025886.1

PREDICTED: Homo sapiens protein tyrosine phosphatase non-receptor type 2 (PTPN2), transcript variant X10, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PTPN2 (5771)
Length:
2058
CDS:
382..1332

Additional Resources:

NCBI RefSeq record:
XM_017025886.1
NBCI Gene record:
PTPN2 (5771)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017025886.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000002784 GTGCAGTAGAATAGACATCAA pLKO.1 1432 3UTR 100% 4.950 6.930 N PTPN2 n/a
2 TRCN0000314551 GTGCAGTAGAATAGACATCAA pLKO_005 1432 3UTR 100% 4.950 6.930 N PTPN2 n/a
3 TRCN0000314692 ATTCTCATACATGGCTATAAT pLKO_005 882 CDS 100% 15.000 12.000 N PTPN2 n/a
4 TRCN0000002783 GAAGATGTGAAGTCGTATTAT pLKO.1 526 CDS 100% 15.000 10.500 N PTPN2 n/a
5 TRCN0000314609 AGAAGATGTGAAGTCGTATTA pLKO_005 525 CDS 100% 13.200 9.240 N PTPN2 n/a
6 TRCN0000314612 GTGGAGAAAGAATCGGTTAAA pLKO_005 430 CDS 100% 13.200 9.240 N PTPN2 n/a
7 TRCN0000002781 GATGACCAAGAGATGCTGTTT pLKO.1 472 CDS 100% 4.950 3.465 N PTPN2 n/a
8 TRCN0000002785 CTCACTTTCATTATACTACCT pLKO.1 602 CDS 100% 2.640 1.848 N PTPN2 n/a
9 TRCN0000002782 TGCAAGATACAATGGAGGAGA pLKO.1 1094 CDS 100% 2.640 1.584 N PTPN2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017025886.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01340 pDONR223 100% 68.9% 68.6% None (many diffs) n/a
2 ccsbBroad304_01340 pLX_304 0% 68.9% 68.6% V5 (many diffs) n/a
3 TRCN0000477545 GTAAGACCTTTGATCCCACTCCAG pLX_317 41.4% 68.9% 68.6% V5 (many diffs) n/a
4 ccsbBroadEn_15554 pDONR223 0% 60.9% 60% None (many diffs) n/a
5 ccsbBroad304_15554 pLX_304 0% 60.9% 60% V5 (many diffs) n/a
6 TRCN0000469804 TACTAGGCCGCAATTGCTATCCCG pLX_317 40.5% 60.9% 60% V5 (many diffs) n/a
Download CSV