Construct: ORF TRCN0000477561
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF006520.1_s317c1
- Derived from:
- ccsbBroadEn_14035
- DNA Barcode:
- GAGGACCTTGAACCGCCCCCGACA
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Early stop codon detected
Originally Annotated References:
- Gene:
- TOM1L1 (10040)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000477561
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 10040 | TOM1L1 | target of myb1 like 1 membr... | NM_001321173.1 | 99.8% | 98.2% | 1017_1018insC;1034G>A |
| 2 | human | 10040 | TOM1L1 | target of myb1 like 1 membr... | NM_005486.3 | 72.6% | 71.4% | 1017_1018insC;1036_1061del;1065_1428del |
| 3 | human | 10040 | TOM1L1 | target of myb1 like 1 membr... | XR_002957936.1 | 56.6% | (many diffs) | |
| 4 | human | 10040 | TOM1L1 | target of myb1 like 1 membr... | NM_001321174.1 | 56.4% | 55.2% | (many diffs) |
| 5 | human | 10040 | TOM1L1 | target of myb1 like 1 membr... | NM_001321175.1 | 56.4% | 55.2% | (many diffs) |
| 6 | human | 10040 | TOM1L1 | target of myb1 like 1 membr... | NM_001321176.1 | 56.4% | 55.2% | (many diffs) |
| 7 | human | 10040 | TOM1L1 | target of myb1 like 1 membr... | XM_017024002.1 | 56.4% | 55.2% | (many diffs) |
| 8 | human | 10040 | TOM1L1 | target of myb1 like 1 membr... | XR_243612.3 | 51.2% | (many diffs) | |
| 9 | human | 10040 | TOM1L1 | target of myb1 like 1 membr... | XR_001752397.2 | 49.3% | (many diffs) | |
| 10 | mouse | 71943 | Tom1l1 | target of myb1-like 1 (chic... | XM_006534269.3 | 55.9% | 56% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1101
- ORF length:
- 1035
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc gtttggcaag agtcaccggg atccctacgc gacctccgtg ggccacctca 121 tagaaaaggc tacatttgct ggagttcaga ctgaagattg gggccagttc atgcacatct 181 gtgacataat taacactacc caggatgggc caaaagatgc agtgaaagct ttgaagaaaa 241 ggatttccaa aaactacaat cataaagaaa tccaacttac cttgtcactt attgacatgt 301 gtgtgcagaa ctgtggtcca agtttccagt ctctgattgt gaagaaggaa tttgttaaag 361 agaatttagt taagctactg aatcccagat acaacttgcc attagacatt cagaatagaa 421 tcttgaattt cattaagact tggtcacagg gcttcccagg aggtgtggat gtaagcgaag 481 tcaaagaagt atacctcgac ctggttaaga aaggcgttca gtttcctccc tcagaagcag 541 aggctgaaac agcaagacaa gagactgctc aaatctcatc aaatcctcca acatctgtcc 601 ctactgcacc agctctttct tctgtaattg ctccaaagaa ctcgactgtt acattggtcc 661 cagaacagat tggaaaactg cacagtgaat tGGATATGGT GAAAATGAAT GTGCGAGTGA 721 TGTCCGCCAT ATTGATGGAG AATACTCCTG GGTCTGAAAA CCATGAAGAC ATAGAGCTTC 781 TGCAGAAACT CTATAAAACA GGTCGGGAGA TGCAGGAGAG GATCATGGAC CTGCTTGTGG 841 TGGTGGAGAA CGAAGATGTA ACTGTTGAGC TAATTCAGGT GAATGAGGAT TTGAATAATG 901 CTATCCTTGG ATATGAGAGG TTTACTAGAA ACCAACAAAG GATTTTGGAG CAAAATAAGA 961 ACCAGAAGGA AGCCACCAAT ACTACCAGTG AGCCTTCTGC CCCATCTCAA GATCTCCTCG 1021 ACCTAAGTCC CAGTCCCCGG ATGCCTAGGG CCACTCTGGG AGAACTCAAC ACCATGAATA 1081 ATCCAACTTT CAGGCTTAAA TAAATACCCA ACTTTCTTGT ACAAAGTGGT TGATATCGGT 1141 AAGCCTATCC CTAACCCTCT CCTCGGTCTC GATTCTACGT AGTAATGAAC TAGTCCGTAA 1201 CTTGAAAGTA TTTCGATTTC TTGGCTTTAT ATATCTTGTG GAAAGGACGA GAGGACCTTG 1261 AACCGCCCCC GACAACGCGT TAAGTCgaca atcaacctct ggattacaaa atttgtgaaa 1321 gatt