Transcript: Human NM_001321174.1

Homo sapiens target of myb1 like 1 membrane trafficking protein (TOM1L1), transcript variant 3, mRNA.

Source:
NCBI, updated 2018-07-01
Taxon:
Homo sapiens (human)
Gene:
TOM1L1 (10040)
Length:
2192
CDS:
243..1442

Additional Resources:

NCBI RefSeq record:
NM_001321174.1
NBCI Gene record:
TOM1L1 (10040)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001321174.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000294029 GCGAGTGATGTCCGCCATATT pLKO_005 659 CDS 100% 13.200 10.560 N TOM1L1 n/a
2 TRCN0000294022 TGATCTCCAGCCACCTAATTA pLKO_005 1313 CDS 100% 15.000 10.500 N TOM1L1 n/a
3 TRCN0000241284 CCTTGGATATGAGAGGTTTAC pLKO_005 851 CDS 100% 10.800 7.560 N Tom1l1 n/a
4 TRCN0000065184 CCAGTTAGTCTACAAACCATT pLKO.1 1227 CDS 100% 4.950 3.465 N TOM1L1 n/a
5 TRCN0000065187 GCCTTGGAGAATACAGAGATA pLKO.1 1116 CDS 100% 4.950 3.465 N TOM1L1 n/a
6 TRCN0000286603 GCCTTGGAGAATACAGAGATA pLKO_005 1116 CDS 100% 4.950 3.465 N TOM1L1 n/a
7 TRCN0000065183 GCTCCAAAGAACTCGACTGTT pLKO.1 576 CDS 100% 4.950 3.465 N TOM1L1 n/a
8 TRCN0000286669 GCTCCAAAGAACTCGACTGTT pLKO_005 576 CDS 100% 4.950 3.465 N TOM1L1 n/a
9 TRCN0000065185 CCCAGATACAACTTGCCATTA pLKO.1 330 CDS 100% 10.800 6.480 N TOM1L1 n/a
10 TRCN0000298249 CCCAGATACAACTTGCCATTA pLKO_005 330 CDS 100% 10.800 6.480 N TOM1L1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001321174.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14035 pDONR223 100% 56.4% 55.2% None (many diffs) n/a
2 ccsbBroad304_14035 pLX_304 0% 56.4% 55.2% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000477561 GAGGACCTTGAACCGCCCCCGACA pLX_317 40% 56.4% 55.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV