Transcript: Human NM_005486.3

Homo sapiens target of myb1 like 1 membrane trafficking protein (TOM1L1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
TOM1L1 (10040)
Length:
2168
CDS:
15..1445

Additional Resources:

NCBI RefSeq record:
NM_005486.3
NBCI Gene record:
TOM1L1 (10040)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005486.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000294029 GCGAGTGATGTCCGCCATATT pLKO_005 662 CDS 100% 13.200 10.560 N TOM1L1 n/a
2 TRCN0000294022 TGATCTCCAGCCACCTAATTA pLKO_005 1316 CDS 100% 15.000 10.500 N TOM1L1 n/a
3 TRCN0000065186 CCAACTTACCTTGTCACTTAT pLKO.1 221 CDS 100% 13.200 9.240 N TOM1L1 n/a
4 TRCN0000241284 CCTTGGATATGAGAGGTTTAC pLKO_005 854 CDS 100% 10.800 7.560 N Tom1l1 n/a
5 TRCN0000065184 CCAGTTAGTCTACAAACCATT pLKO.1 1230 CDS 100% 4.950 3.465 N TOM1L1 n/a
6 TRCN0000065187 GCCTTGGAGAATACAGAGATA pLKO.1 1119 CDS 100% 4.950 3.465 N TOM1L1 n/a
7 TRCN0000286603 GCCTTGGAGAATACAGAGATA pLKO_005 1119 CDS 100% 4.950 3.465 N TOM1L1 n/a
8 TRCN0000065183 GCTCCAAAGAACTCGACTGTT pLKO.1 579 CDS 100% 4.950 3.465 N TOM1L1 n/a
9 TRCN0000286669 GCTCCAAAGAACTCGACTGTT pLKO_005 579 CDS 100% 4.950 3.465 N TOM1L1 n/a
10 TRCN0000065185 CCCAGATACAACTTGCCATTA pLKO.1 333 CDS 100% 10.800 6.480 N TOM1L1 n/a
11 TRCN0000298249 CCCAGATACAACTTGCCATTA pLKO_005 333 CDS 100% 10.800 6.480 N TOM1L1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005486.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14035 pDONR223 100% 72.6% 71.4% None 1017_1018insC;1036_1061del;1065_1428del n/a
2 ccsbBroad304_14035 pLX_304 0% 72.6% 71.4% V5 (not translated due to prior stop codon) 1017_1018insC;1036_1061del;1065_1428del n/a
3 TRCN0000477561 GAGGACCTTGAACCGCCCCCGACA pLX_317 40% 72.6% 71.4% V5 (not translated due to prior stop codon) 1017_1018insC;1036_1061del;1065_1428del n/a
Download CSV