Transcript: Human XM_024453834.1

PREDICTED: Homo sapiens IQ motif containing B1 (IQCB1), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
IQCB1 (9657)
Length:
2700
CDS:
872..2116

Additional Resources:

NCBI RefSeq record:
XM_024453834.1
NBCI Gene record:
IQCB1 (9657)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024453834.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000323023 ACTAGGGCCATCCTAACTTAT pLKO_005 2192 3UTR 100% 13.200 18.480 N IQCB1 n/a
2 TRCN0000128434 GCAGTCTCTCATAGAGTATAA pLKO.1 1552 CDS 100% 13.200 18.480 N IQCB1 n/a
3 TRCN0000323021 GCAGTCTCTCATAGAGTATAA pLKO_005 1552 CDS 100% 13.200 18.480 N IQCB1 n/a
4 TRCN0000323096 TGTACTACAAAGTGATCATTT pLKO_005 805 5UTR 100% 13.200 18.480 N IQCB1 n/a
5 TRCN0000129643 CTGACAATGTCCAAATAGGAT pLKO.1 843 5UTR 100% 3.000 2.400 N IQCB1 n/a
6 TRCN0000128506 CAAGCTGACAATGTCCAAATA pLKO.1 839 5UTR 100% 13.200 9.240 N IQCB1 n/a
7 TRCN0000323093 CAAGCTGACAATGTCCAAATA pLKO_005 839 5UTR 100% 13.200 9.240 N IQCB1 n/a
8 TRCN0000129153 GAGCAGAATGTCCCTGTTATA pLKO.1 192 5UTR 100% 13.200 9.240 N IQCB1 n/a
9 TRCN0000323022 AGCTGAGTATGCTCGAAATAG pLKO_005 1419 CDS 100% 13.200 7.920 N IQCB1 n/a
10 TRCN0000128063 CCAGAAACATTGGAGAGGGTA pLKO.1 1501 CDS 100% 2.640 1.584 N IQCB1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024453834.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07460 pDONR223 100% 75.4% 63.5% None (many diffs) n/a
2 ccsbBroad304_07460 pLX_304 0% 75.4% 63.5% V5 (many diffs) n/a
3 TRCN0000477662 CACTCCCACCTTTCACAGCGTCTC pLX_317 15.9% 75.4% 63.5% V5 (many diffs) n/a
Download CSV