Construct: ORF TRCN0000477685
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF004502.1_s317c1
- Derived from:
- ccsbBroadEn_15891
- DNA Barcode:
- GACTAGGCCCTCAAGGGAAGAATA
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Early stop codon detected
Originally Annotated References:
- Gene:
- PCMTD2 (55251)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000477685
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 55251 | PCMTD2 | protein-L-isoaspartate (D-a... | NM_018257.3 | 72.2% | 45.7% | 1_164del;203_338del;820_821insC |
| 2 | human | 55251 | PCMTD2 | protein-L-isoaspartate (D-a... | NM_001104925.1 | 64.7% | 38.2% | (many diffs) |
| 3 | mouse | 245867 | Pcmtd2 | protein-L-isoaspartate (D-a... | XM_006500626.3 | 33.6% | 42.9% | (many diffs) |
| 4 | mouse | 245867 | Pcmtd2 | protein-L-isoaspartate (D-a... | XM_006500627.3 | 33.4% | 42.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 600
- ORF length:
- 531
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggaagcatgg aaacattcac ctctcagccc cgtgcatcac tcagatgtga 121 tagagtatgc aaagcagaaa ctggacttct tcatcagaac aagtgatagt tttgacaagt 181 ttgacttctg tgaaccttcc tttgttactg ggaattgcct ggagatttct ccggattgtt 241 ctcagtatga tcgtgtatac tgtggggctg gcgtgcagaa agagcatgaa gagtacatga 301 agaatcttct caaagtggga gggatccttg tcatgccact ggaagagaag ttgactaaga 361 taacacgcac aggtccttca gcttgggaaa ccaaaaagat tcttgctgtt tcttttgctc 421 ctctgatcca gccctgccat tcagagtcag gaaaatcaag acttgtccag ttaccaccag 481 tggcagttcg cagccTCCAG GACTTGGCTC GCATCGCCAT CCGGGGCACC ATTAAAAAGA 541 TTATTCATCA GGAAACTGTG AGCAAAAACG GAAACGGACT AAAGAACACC CCCCAGGTTT 601 AAACGAAGGA GAGTTCGCCG CCGTCGAATG GAAACGATTG TCTTTTTGGA CAAAGAAGTC 661 TTTGCCAGTC GGATTTCCAA CCCCTCAGAT GACAACAGCT GTGAAGACTT GGAAGAGGAA 721 CGGAGGGAAG AAGAAGAGAA GACCCCGCCG GAAACAAAGC CAGACCCCCC AGTGAACTTC 781 CTACGCCAGA AGGTCCTGAG CCTCCCTCTG CCAGATCCCC TGAAATACTA CTTGCTTTAT 841 TACAGAGAAA AATTGCCAAC TTTCTTGTAC AAAGTGGTTG ATATCGGTAA GCCTATCCCT 901 AACCCTCTCC TCGGTCTCGA TTCTACGTAG TAATGAACTA GTCCGTAACT TGAAAGTATT 961 TCGATTTCTT GGCTTTATAT ATCTTGTGGA AAGGACGAGA CTAGGCCCTC AAGGGAAGAA 1021 TAACGCGTTA AGTCgacaat caacctctgg attacaaaat ttgtgaaaga tt