Transcript: Human NM_018257.3

Homo sapiens protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 2 (PCMTD2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
PCMTD2 (55251)
Length:
3859
CDS:
148..1233

Additional Resources:

NCBI RefSeq record:
NM_018257.3
NBCI Gene record:
PCMTD2 (55251)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_018257.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000020367 CATCAGAACAAGTGATAGTTT pLKO.1 531 CDS 100% 5.625 7.875 N PCMTD2 n/a
2 TRCN0000020368 CGCCGTCGAATGGAAACGATT pLKO.1 997 CDS 100% 4.950 6.930 N PCMTD2 n/a
3 TRCN0000275919 AGTCTTTGCCAGTCGGATTTC pLKO_005 1035 CDS 100% 10.800 8.640 N PCMTD2 n/a
4 TRCN0000275860 TGTGAAAGCACAAGCTTATAA pLKO_005 1642 3UTR 100% 15.000 10.500 N PCMTD2 n/a
5 TRCN0000275859 ACTCAGATGTGATAGAGTATG pLKO_005 488 CDS 100% 10.800 7.560 N PCMTD2 n/a
6 TRCN0000020366 CCGGATTGTTCTCAGTATGAT pLKO.1 610 CDS 100% 5.625 3.938 N PCMTD2 n/a
7 TRCN0000020364 GCAGACTATTATCTTGAAGAA pLKO.1 262 CDS 100% 4.950 3.465 N PCMTD2 n/a
8 TRCN0000020365 GCATGAAGAGTACATGAAGAA pLKO.1 663 CDS 100% 4.950 3.465 N PCMTD2 n/a
9 TRCN0000275858 TGATGAGCTGATAGATAATTT pLKO_005 180 CDS 100% 15.000 9.000 N PCMTD2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018257.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03563 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03563 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000472521 TCGCCTAACAACGGCCTAGTCTGC pLX_317 38.8% 100% 100% V5 n/a
4 ccsbBroadEn_15891 pDONR223 0% 72.2% 69.5% None 1_164del;203_338del n/a
5 ccsbBroad304_15891 pLX_304 0% 72.2% 69.5% V5 1_164del;203_338del n/a
6 TRCN0000477685 GACTAGGCCCTCAAGGGAAGAATA pLX_317 45.6% 72.2% 45.7% V5 (not translated due to prior stop codon) 1_164del;203_338del;820_821insC n/a
Download CSV