Construct: ORF TRCN0000477832
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF015778.1_s317c1
- Derived from:
- ccsbBroadEn_01530
- DNA Barcode:
- AATCCATTACCCAAGTTTACTACT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SHBG (6462)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000477832
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 6462 | SHBG | sex hormone binding globulin | NM_001040.5 | 100% | 100% | |
| 2 | human | 6462 | SHBG | sex hormone binding globulin | NM_001146279.3 | 95.5% | 95.5% | 554_555ins54 |
| 3 | human | 6462 | SHBG | sex hormone binding globulin | NM_001289113.1 | 85.5% | 85.5% | 0_1ins174 |
| 4 | human | 6462 | SHBG | sex hormone binding globulin | NM_001289114.1 | 85.5% | 85.5% | 0_1ins174 |
| 5 | human | 6462 | SHBG | sex hormone binding globulin | NM_001146280.3 | 72.8% | 71.3% | 852_853ins208;879_880ins119 |
| 6 | human | 6462 | SHBG | sex hormone binding globulin | NM_001146281.2 | 71.3% | 71.3% | 713_714ins345 |
| 7 | human | 6462 | SHBG | sex hormone binding globulin | NM_001289116.2 | 71.1% | 64.1% | 0_1ins256;98_99ins92 |
| 8 | human | 6462 | SHBG | sex hormone binding globulin | NM_001289115.1 | 58.4% | 56.9% | 0_1ins174;678_679ins208;705_706ins119 |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1275
- ORF length:
- 1206
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggagagcaga ggcccactgg ctacctcgcg cctgctgctg ttgctgctgt 121 tgctactact gcgtcacacc cgccagggat gggccctgag acctgttctc cccacccaga 181 gtgcccacga ccctccggct gtccacctca gcaatggccc aggacaagag cctatcgctg 241 tcatgacctt tgacctcacc aagatcacaa aaacctcctc ctcctttgag gttcgaacct 301 gggacccaga gggagtgatt ttttatgggg ataccaaccc taaggatgac tggtttatgc 361 tgggacttcg agacggcagg cctgagatcc aactgcacaa tcactgggcc cagcttacgg 421 tgggtgctgg accacggctg gatgatggga gatggcacca ggtggaagtc aagatggagg 481 gggactctgt gctgctggag gtggatgggg aggaggtgct gcgcctgaga caggtctctg 541 ggcccctgac cagcaaacgc catcccatca tgaggattgc gcttgggggg ctgctcttcc 601 ccgcttccaa ccttcggttg ccgctggttc ctgccctgga tggctgcctg cgccgggatt 661 cctggctgga caaacaggcc gagatctcag catctgcccc cactagcctc agaagctgtg 721 atgtagaatc aaatcccggg atatttctcc ctccagggac tcaggcagaa ttcaatctcc 781 gagacattcc ccagcctcat gcagagccct gggccttctc tttggacctg ggactcaagc 841 aggcagcagg ctcaggccac ctccttgctc ttgggacacc agagaaccca tcttggctca 901 gtctccacct ccaagatcaa aaggtggtgt tgtcttcTGG GTCGGGGCCA GGGCTGGATC 961 TGCCCCTGGT CTTGGGACTC CCTCTTCAGC TGAAGCTGAG TATGTCCAGG GTGGTCTTGA 1021 GCCAAGGGTC GAAGATGAAG GCCCTTGCCC TGCCTCCCTT AGGCCTGGCT CCCCTCCTTA 1081 ACCTCTGGGC CAAGCCTCAA GGGCGTCTCT TCCTGGGGGC TTTACCAGGA GAAGACTCTT 1141 CCACCTCTTT TTGCCTGAAT GGCCTTTGGG CACAAGGTCA GAGGCTGGAT GTGGACCAGG 1201 CCCTGAACAG AAGCCATGAG ATCTGGACTC ACAGCTGCCC CCAGAGCCCA GGCAATGGCA 1261 CTGACGCTTC CCATTTGCCA ACTTTCTTGT ACAAAGTGGT TGATATCGGT AAGCCTATCC 1321 CTAACCCTCT CCTCGGTCTC GATTCTACGT AGTAATGAAC TAGTCCGTAA CTTGAAAGTA 1381 TTTCGATTTC TTGGCTTTAT ATATCTTGTG GAAAGGACGA AATCCATTAC CCAAGTTTAC 1441 TACTACGCGT TAAGTCgaca atcaacctct ggattacaaa atttgtgaaa gatt