Transcript: Human NM_001289113.1

Homo sapiens sex hormone binding globulin (SHBG), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
SHBG (6462)
Length:
1326
CDS:
247..1281

Additional Resources:

NCBI RefSeq record:
NM_001289113.1
NBCI Gene record:
SHBG (6462)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001289113.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422948 GCCATCCCATCATGAGGATTG pLKO_005 563 CDS 100% 6.000 4.800 N SHBG n/a
2 TRCN0000414196 AGCTGTGATGTAGAATCAAAT pLKO_005 718 CDS 100% 13.200 9.240 N SHBG n/a
3 TRCN0000083288 CCCTAAGGATGACTGGTTTAT pLKO.1 342 CDS 100% 13.200 9.240 N SHBG n/a
4 TRCN0000418632 GGCACTGACGCTTCCCATTAA pLKO_005 1261 CDS 100% 13.200 9.240 N SHBG n/a
5 TRCN0000083292 CCTATCGCTGTCATGACCTTT pLKO.1 235 5UTR 100% 4.950 3.465 N SHBG n/a
6 TRCN0000083289 CCTGAGATCCAACTGCACAAT pLKO.1 385 CDS 100% 4.950 3.465 N SHBG n/a
7 TRCN0000083290 CAACCCTAAGGATGACTGGTT pLKO.1 339 CDS 100% 2.640 1.848 N SHBG n/a
8 TRCN0000083291 GAATTCAATCTCCGAGACATT pLKO.1 772 CDS 100% 0.000 0.000 N SHBG n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001289113.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01530 pDONR223 100% 85.5% 85.5% None 0_1ins174 n/a
2 ccsbBroad304_01530 pLX_304 0% 85.5% 85.5% V5 0_1ins174 n/a
3 TRCN0000477832 AATCCATTACCCAAGTTTACTACT pLX_317 28.3% 85.5% 85.5% V5 0_1ins174 n/a
Download CSV