Transcript: Human NM_001289116.2

Homo sapiens sex hormone binding globulin (SHBG), transcript variant 8, mRNA.

Source:
NCBI, updated 2019-08-09
Taxon:
Homo sapiens (human)
Gene:
SHBG (6462)
Length:
1175
CDS:
295..1155

Additional Resources:

NCBI RefSeq record:
NM_001289116.2
NBCI Gene record:
SHBG (6462)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001289116.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422948 GCCATCCCATCATGAGGATTG pLKO_005 437 CDS 100% 6.000 4.800 N SHBG n/a
2 TRCN0000414196 AGCTGTGATGTAGAATCAAAT pLKO_005 592 CDS 100% 13.200 9.240 N SHBG n/a
3 TRCN0000083288 CCCTAAGGATGACTGGTTTAT pLKO.1 308 CDS 100% 13.200 9.240 N SHBG n/a
4 TRCN0000418632 GGCACTGACGCTTCCCATTAA pLKO_005 1135 CDS 100% 13.200 9.240 N SHBG n/a
5 TRCN0000083292 CCTATCGCTGTCATGACCTTT pLKO.1 201 5UTR 100% 4.950 3.465 N SHBG n/a
6 TRCN0000083289 CCTGAGATCCAACTGCACAAT pLKO.1 351 CDS 100% 4.950 3.465 N SHBG n/a
7 TRCN0000420838 GTTGCTACTACTGCGTCACAC pLKO_005 89 5UTR 100% 4.050 2.835 N SHBG n/a
8 TRCN0000083290 CAACCCTAAGGATGACTGGTT pLKO.1 305 CDS 100% 2.640 1.848 N SHBG n/a
9 TRCN0000083291 GAATTCAATCTCCGAGACATT pLKO.1 646 CDS 100% 0.000 0.000 N SHBG n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001289116.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01530 pDONR223 100% 71.1% 64.1% None 0_1ins256;98_99ins92 n/a
2 ccsbBroad304_01530 pLX_304 0% 71.1% 64.1% V5 0_1ins256;98_99ins92 n/a
3 TRCN0000477832 AATCCATTACCCAAGTTTACTACT pLX_317 28.3% 71.1% 64.1% V5 0_1ins256;98_99ins92 n/a
Download CSV