Construct: ORF TRCN0000477838
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF002874.1_s317c1
- Derived from:
- ccsbBroadEn_02575
- DNA Barcode:
- CGTGCCCCAGCCAGTCATCTACGA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- ERP29 (10961)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000477838
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 10961 | ERP29 | endoplasmic reticulum prote... | NM_006817.4 | 100% | 100% | |
| 2 | human | 10961 | ERP29 | endoplasmic reticulum prote... | XM_017018720.1 | 61.3% | 61.3% | 0_1ins303 |
| 3 | human | 10961 | ERP29 | endoplasmic reticulum prote... | NM_001034025.1 | 19.9% | 18.7% | (many diffs) |
| 4 | mouse | 67397 | Erp29 | endoplasmic reticulum prote... | NM_026129.2 | 86.7% | 87.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 852
- ORF length:
- 783
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggctgccgct gtgccccgcg ccgcatttct ctccccgctg cttccccttc 121 tcctgggctt cctgctcctc tccgctccgc atggcggcag cggcctgcac accaagggcg 181 cccttcccct ggatacggtc actttctaca aggtcattcc caaaagcaag ttcgtcttgg 241 tgaagttcga cacccagtac ccctacggtg agaagcagga tgagttcaag cgtcttgctg 301 aaaactcggc ttccagcgat gatctcttgg tggcagaggt ggggatctca gattatggtg 361 acaagctgaa catggagctg agtgagaaat acaagctgga caaagagagc tacccagtct 421 tctacctctt ccgggatggg gactttgaga acccagtccc atacactggg gcagttaagg 481 ttggagccat ccagcgctgg ctgaaggggc aaggggtcta cctaggtatg cctggttgcc 541 tgcctgtata cgacgccctg gccggggagt tcatcagggc ctctggtgtg gaggcccgcc 601 aggccctctt gaagcagggg caagataacc tcTCAAGTGT GAAGGAGACT CAGAAGAAGT 661 GGGCCGAGCA ATACCTGAAG ATCATGGGGA AGATCTTAGA CCAAGGGGAG GACTTCCCAG 721 CATCAGAGAT GACACGGATC GCCAGGCTGA TTGAGAAGAA CAAGATGAGT GACGGGAAGA 781 AGGAGGAGCT CCAGAAGAGC TTAAACATCC TGACTGCCTT CCAGAAGAAG GGGGCCGAGA 841 AAGAGGAGCT GTTGCCAACT TTCTTGTACA AAGTGGTTGA TATCGGTAAG CCTATCCCTA 901 ACCCTCTCCT CGGTCTCGAT TCTACGTAGT AATGAACTAG TCCGTAACTT GAAAGTATTT 961 CGATTTCTTG GCTTTATATA TCTTGTGGAA AGGACGACGT GCCCCAGCCA GTCATCTACG 1021 AACGCGTTAA GTCgacaatc aacctctgga ttacaaaatt tgtgaaagat t