Transcript: Human XM_017018720.1

PREDICTED: Homo sapiens endoplasmic reticulum protein 29 (ERP29), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ERP29 (10961)
Length:
1111
CDS:
291..773

Additional Resources:

NCBI RefSeq record:
XM_017018720.1
NBCI Gene record:
ERP29 (10961)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017018720.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000029316 CCGAGCAATACCTGAAGATCA pLKO.1 583 CDS 100% 4.950 3.960 N ERP29 n/a
2 TRCN0000424466 GATCGCCAGGCTGATTGAGAA pLKO_005 656 CDS 100% 4.950 3.960 N ERP29 n/a
3 TRCN0000430115 TGAGTCCCTTGTGGAATATAA pLKO_005 839 3UTR 100% 15.000 10.500 N ERP29 n/a
4 TRCN0000426187 CCGAGAAAGAGGAGCTGTAAA pLKO_005 754 CDS 100% 13.200 9.240 N ERP29 n/a
5 TRCN0000417494 CAGAAGGAATGAGTGCTATAG pLKO_005 1008 3UTR 100% 10.800 7.560 N ERP29 n/a
6 TRCN0000029314 GCTCCAGAAGAGCTTAAACAT pLKO.1 707 CDS 100% 5.625 3.938 N ERP29 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017018720.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02575 pDONR223 100% 61.3% 61.3% None 0_1ins303 n/a
2 ccsbBroad304_02575 pLX_304 0% 61.3% 61.3% V5 0_1ins303 n/a
3 TRCN0000477838 CGTGCCCCAGCCAGTCATCTACGA pLX_317 28.5% 61.3% 61.3% V5 0_1ins303 n/a
Download CSV