Transcript: Human NM_006817.4

Homo sapiens endoplasmic reticulum protein 29 (ERP29), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
ERP29 (10961)
Length:
1623
CDS:
41..826

Additional Resources:

NCBI RefSeq record:
NM_006817.4
NBCI Gene record:
ERP29 (10961)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006817.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000029316 CCGAGCAATACCTGAAGATCA pLKO.1 636 CDS 100% 4.950 3.960 N ERP29 n/a
2 TRCN0000424466 GATCGCCAGGCTGATTGAGAA pLKO_005 709 CDS 100% 4.950 3.960 N ERP29 n/a
3 TRCN0000430115 TGAGTCCCTTGTGGAATATAA pLKO_005 892 3UTR 100% 15.000 10.500 N ERP29 n/a
4 TRCN0000426187 CCGAGAAAGAGGAGCTGTAAA pLKO_005 807 CDS 100% 13.200 9.240 N ERP29 n/a
5 TRCN0000417494 CAGAAGGAATGAGTGCTATAG pLKO_005 1061 3UTR 100% 10.800 7.560 N ERP29 n/a
6 TRCN0000374552 TCACTTTCTACAAGGTCATTC pLKO_005 171 CDS 100% 10.800 7.560 N Erp29 n/a
7 TRCN0000029314 GCTCCAGAAGAGCTTAAACAT pLKO.1 760 CDS 100% 5.625 3.938 N ERP29 n/a
8 TRCN0000029315 GATCTCAGATTATGGTGACAA pLKO.1 316 CDS 100% 4.950 3.465 N ERP29 n/a
9 TRCN0000029317 CAAGTTCGTCTTGGTGAAGTT pLKO.1 199 CDS 100% 4.950 2.970 N ERP29 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006817.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02575 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02575 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000477838 CGTGCCCCAGCCAGTCATCTACGA pLX_317 28.5% 100% 100% V5 n/a
Download CSV