Construct: ORF TRCN0000477867
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF009758.1_s317c1
- Derived from:
- ccsbBroadEn_09751
- DNA Barcode:
- TCTCACATGCCCCCGCATCGTTAC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PLPPR5 (163404)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000477867
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 163404 | PLPPR5 | phospholipid phosphatase re... | NM_001037317.2 | 99.8% | 99.6% | 268C>A |
2 | human | 163404 | PLPPR5 | phospholipid phosphatase re... | NM_001010861.3 | 98.3% | 98.1% | 268C>A;916_917insAGGTAACATCTGTAC |
3 | human | 163404 | PLPPR5 | phospholipid phosphatase re... | XM_011540836.2 | 97.9% | 96.5% | (many diffs) |
4 | human | 163404 | PLPPR5 | phospholipid phosphatase re... | XM_011540837.1 | 96.3% | 95.6% | (many diffs) |
5 | human | 163404 | PLPPR5 | phospholipid phosphatase re... | XM_011540838.3 | 94.9% | 94.7% | 0_1ins48;220C>A |
6 | mouse | 75769 | Plppr5 | phospholipid phosphatase re... | NM_001305451.1 | 89.4% | 95.3% | (many diffs) |
7 | mouse | 75769 | Plppr5 | phospholipid phosphatase re... | NM_029425.3 | 88% | 94% | (many diffs) |
8 | mouse | 75769 | Plppr5 | phospholipid phosphatase re... | XM_006502235.3 | 61.7% | 63.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1032
- ORF length:
- 963
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gcccctgctg cccgcggcgc tcaccagcag catgctctat ttccagatgg 121 tgatcatggc agggacggtg atgctggcgt actacttcga gtatacggac acgttcaccg 181 tgaacgtgca gggcttcttc tgccacgaca gcgcctaccg caaaccctac ccgggcccgg 241 aggacagcag cgccgtgccc cccgtgctcc tctactcgct ggccgccggg gtccccgtgc 301 tcgtgataat agttggagaa actgctgtct tttgcataca actagccaca agggattttg 361 aaaaccagga aaaaactatt ttaactggag actgttgcta tataaacccg ctggtgcgcc 421 gaactgtccg atttcttgga atttatacat ttggactgtt tgctacagat atctttgtaa 481 atgctggaca agtagtcaca ggaaatctgg CCCCACATTT CCTTGCCCTG TGTAAGCCCA 541 ATTATACAGC ACTTGGATGT CAGCAGTATA CACAATTCAT CAGTGGGGAA GAGGCCTGTA 601 CTGGCAACCC AGATCTCATC ATGAGAGCCC GAAAAACCTT TCCATCCAAA GAAGCAGCTC 661 TCAGTGTCTA TGCAGCTATG TATCTGACCA TGTACATCAC CAACACAATC AAAGCCAAGG 721 GAACCAGACT TGCTAAGCCA GTTCTATGCT TGGGCTTAAT GTGTTTGGCA TTTCTTACTG 781 GACTCAACAG AGTAGCAGAA TATCGAAATC ATTGGTCAGA TGTTATAGCA GGCTTTCTGG 841 TTGGAATATC TATAGCAGTA TTTCTGGTTG TGTGCGTGGT GAATAATTTC AAAGGGAGAC 901 AAGCAGAAAA TGAGCATATA CACATGGATA ATCTGGCACA GATGCCAATG ATCAGCATTC 961 CTCGAGTAGA AAGTCCTTTG GAAAAGGTAA CATCTGTACA GAACCACATC ACTGCCTTCG 1021 CAGAAGTCAC ATTGCCAACT TTCTTGTACA AAGTGGTTGA TATCGGTAAG CCTATCCCTA 1081 ACCCTCTCCT CGGTCTCGAT TCTACGTAGT AATGAACTAG TCCGTAACTT GAAAGTATTT 1141 CGATTTCTTG GCTTTATATA TCTTGTGGAA AGGACGATCT CACATGCCCC CGCATCGTTA 1201 CACGCGTTAA GTCgacaatc aacctctgga ttacaaaatt tgtgaaagat t