Transcript: Human XM_011540837.1

PREDICTED: Homo sapiens phospholipid phosphatase related 5 (PLPPR5), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PLPPR5 (163404)
Length:
1279
CDS:
217..1152

Additional Resources:

NCBI RefSeq record:
XM_011540837.1
NBCI Gene record:
PLPPR5 (163404)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011540837.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000359855 CCCTGTGTAAGCCCAATTATA pLKO_005 674 CDS 100% 15.000 21.000 N PLPPR5 n/a
2 TRCN0000359854 GTCCGATTTCTTGGAATTTAT pLKO_005 574 CDS 100% 15.000 21.000 N PLPPR5 n/a
3 TRCN0000359856 TGGCGTACTACTTCGAGTATA pLKO_005 293 CDS 100% 13.200 18.480 N PLPPR5 n/a
4 TRCN0000082792 CTTCGAGTATACGGACACGTT pLKO.1 303 CDS 100% 2.640 3.696 N PLPPR5 n/a
5 TRCN0000082790 CAGTTCTATGCTTGGGCTTAA pLKO.1 887 CDS 100% 10.800 7.560 N PLPPR5 n/a
6 TRCN0000082791 GCAGGCTTTCTGGTTGGAATA pLKO.1 976 CDS 100% 10.800 7.560 N PLPPR5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011540837.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09751 pDONR223 100% 96.3% 95.6% None (many diffs) n/a
2 ccsbBroad304_09751 pLX_304 0% 96.3% 95.6% V5 (many diffs) n/a
3 TRCN0000477867 TCTCACATGCCCCCGCATCGTTAC pLX_317 53.9% 96.3% 95.6% V5 (many diffs) n/a
Download CSV