Transcript: Mouse NM_001305451.1

Mus musculus phospholipid phosphatase related 5 (Plppr5), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Plppr5 (75769)
Length:
4295
CDS:
470..1435

Additional Resources:

NCBI RefSeq record:
NM_001305451.1
NBCI Gene record:
Plppr5 (75769)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001305451.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000081095 CTGCAATTAGCCACAAGAGAT pLKO.1 737 CDS 100% 4.950 6.930 N Plppr5 n/a
2 TRCN0000081094 CCGTCCGATTTCTTGGAATTT pLKO.1 825 CDS 100% 13.200 10.560 N Plppr5 n/a
3 TRCN0000359854 GTCCGATTTCTTGGAATTTAT pLKO_005 827 CDS 100% 15.000 10.500 N PLPPR5 n/a
4 TRCN0000081093 CCCAAGATACTTTGACTTAAA pLKO.1 3028 3UTR 100% 13.200 9.240 N Plppr5 n/a
5 TRCN0000081096 CGGATGCCAATGACCAACATT pLKO.1 1340 CDS 100% 5.625 3.938 N Plppr5 n/a
6 TRCN0000081097 CCGGATGCCAATGACCAACAT pLKO.1 1339 CDS 100% 4.950 3.465 N Plppr5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001305451.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09751 pDONR223 100% 89.4% 95.3% None (many diffs) n/a
2 ccsbBroad304_09751 pLX_304 0% 89.4% 95.3% V5 (many diffs) n/a
3 TRCN0000477867 TCTCACATGCCCCCGCATCGTTAC pLX_317 53.9% 89.4% 95.3% V5 (many diffs) n/a
Download CSV