Construct: ORF TRCN0000477872
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF017666.1_s317c1
- Derived from:
- ccsbBroadEn_06243
- DNA Barcode:
- CGCTTCTCACAGATCCAGCAAGTC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- GABRB2 (2561)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000477872
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 2561 | GABRB2 | gamma-aminobutyric acid typ... | NM_000813.3 | 99.7% | 99.7% | 674C>A;789C>A;1194C>T |
2 | human | 2561 | GABRB2 | gamma-aminobutyric acid typ... | NM_001371727.1 | 92.3% | 92.3% | (many diffs) |
3 | human | 2561 | GABRB2 | gamma-aminobutyric acid typ... | NM_021911.2 | 92.3% | 92.3% | (many diffs) |
4 | mouse | 14401 | Gabrb2 | gamma-aminobutyric acid (GA... | NM_008070.3 | 91% | 99.5% | (many diffs) |
5 | mouse | 14401 | Gabrb2 | gamma-aminobutyric acid (GA... | XM_017314261.1 | 91% | 99.5% | (many diffs) |
6 | mouse | 14401 | Gabrb2 | gamma-aminobutyric acid (GA... | NM_001347314.1 | 84.3% | 92.1% | (many diffs) |
7 | mouse | 14401 | Gabrb2 | gamma-aminobutyric acid (GA... | XM_011248726.1 | 84.3% | 92.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1491
- ORF length:
- 1422
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gtggagagtg cggaaaaggg gctactttgg gatttggtcc ttccccttaa 121 taatcgccgc tgtctgtgcg cagagtgtca atgaccctag taatatgtcg ctggttaaag 181 agacggtgga tagactcctg aaaggctatg acattcgtct gagaccagat tttggaggtc 241 cccccgtggc tgtggggatg aacattgaca ttgccagcat cgatatggtt tctgaagtca 301 atatggatta taccttgaca atgtactttc aacaagcctg gagagataag aggctgtcct 361 ataatgtaat acctttaaac ttgactctgg acaacagagt ggcagaccag ctctgggtgc 421 ctgataccta tttcctgaac gataagaagt catttgtgca cggagtgact gttaagaacc 481 gcatgattcg cctgcatcct gatggcaccg tcctttatgg actcagaatc acaaccacag 541 ctgcctgcat gatggaccta aggaggtacc cactggatga acaaaactgc accttggaaa 601 ttgagagcta tggatacaca actgatgaca ttgagtttta ctggcgtggc gatgataatg 661 cagtaacagg agtaacgaaa attgaacttc cacagttctc tattgtagat tacaaactta 721 tcaccaagaa ggttgttttt tacacaggtt cctatcccag gttatccctc agctttaagc 781 ttaagagaaa cattggctac tttatcctgc aaacatacat gccttccatc ctgattacca 841 tcctctcctg ggtctcattc tggattaatt acgatgcttc agctgcaagg gtggcattag 901 gaatcacaac tgtcctcaca atgaccacaa tcaacaccca cctccgggaa actctcccta 961 aaatccccta tgtgaaggcc attgacatgt acctgatggg gtgctttgtc ttcgttttca 1021 tggcccttct ggaatatgcc ctagtcaact acaTCTTCTT TGGGAGGGGG CCCCAACGCC 1081 AAAAGAAAGC AGCTGAGAAG GCTGCCAGTG CCAACAATGA GAAGATGCGC CTGGATGTCA 1141 ACAAGATGGA CCCCCATGAG AACATCTTAC TGAGCACTCT CGAGATAAAA AATGAAATGG 1201 CCACATCTGA GGCTGTGATG GGACTTGGAG ACCCCAGAAG CACAATGCTA GCCTATGATG 1261 CTTCCAGCAT CCAGTATCGG AAAGCTGGGT TGCCCAGGCA TAGTTTTGGC CGAAATGCTC 1321 TGGAACGACA TGTGGCGCAA AAGAAAAGTC GCCTGAGGAG ACGCGCCTCC CAACTGAAAA 1381 TCACCATCCC TGACTTGACT GATGTGAATG CCATAGATCG GTGGTCCCGC ATATTCTTCC 1441 CAGTGGTTTT TTCCTTCTTC AACATCGTCT ATTGGCTTTA TTATGTGAAC TTGCCAACTT 1501 TCTTGTACAA AGTGGTTGAT ATCGGTAAGC CTATCCCTAA CCCTCTCCTC GGTCTCGATT 1561 CTACGTAGTA ATGAACTAGT CCGTAACTTG AAAGTATTTC GATTTCTTGG CTTTATATAT 1621 CTTGTGGAAA GGACGACGCT TCTCACAGAT CCAGCAAGTC ACGCGTTAAG TCgacaatca 1681 acctctggat tacaaaattt gtgaaagatt