Transcript: Human NM_001371727.1

Homo sapiens gamma-aminobutyric acid type A receptor beta2 subunit (GABRB2), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-15
Taxon:
Homo sapiens (human)
Gene:
GABRB2 (2561)
Length:
7266
CDS:
83..1621

Additional Resources:

NCBI RefSeq record:
NM_001371727.1
NBCI Gene record:
GABRB2 (2561)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001371727.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000432478 GATAAGAGGCTGTCCTATAAT pLKO_005 359 CDS 100% 15.000 21.000 N GABRB2 n/a
2 TRCN0000436857 GGCCTATCCTGTGGTCCATTT pLKO_005 1744 3UTR 100% 10.800 15.120 N GABRB2 n/a
3 TRCN0000061397 CGTGGCGATGATAATGCAGTA pLKO.1 659 CDS 100% 4.050 5.670 N GABRB2 n/a
4 TRCN0000434070 ATTACTTGAAGATGATCTATG pLKO_005 2062 3UTR 100% 10.800 7.560 N GABRB2 n/a
5 TRCN0000433223 TCCTGATGGCACCGTCCTTTA pLKO_005 511 CDS 100% 10.800 7.560 N GABRB2 n/a
6 TRCN0000061393 CCTCACAATGACCACAATCAA pLKO.1 928 CDS 100% 5.625 3.938 N GABRB2 n/a
7 TRCN0000061396 CCTGAACGATAAGAAGTCATT pLKO.1 448 CDS 100% 4.950 3.465 N GABRB2 n/a
8 TRCN0000061395 CCTAGTAATATGTCGCTGGTT pLKO.1 170 CDS 100% 2.640 1.848 N GABRB2 n/a
9 TRCN0000061394 CGCATATTCTTCCCAGTGGTT pLKO.1 1556 CDS 100% 2.640 1.848 N GABRB2 n/a
10 TRCN0000216244 CAATCATGCCATTTGGCTATA pLKO.1 5507 3UTR 100% 10.800 7.560 N Ifit1bl2 n/a
11 TRCN0000166364 CACACACACACACACACACAA pLKO.1 5889 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001371727.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00607 pDONR223 100% 92.5% 92.5% None 1077_1190del n/a
2 ccsbBroad304_00607 pLX_304 0% 92.5% 92.5% V5 1077_1190del n/a
3 TRCN0000473027 ATTAGACTACACAGATAACTCATG pLX_317 32% 92.5% 92.5% V5 1077_1190del n/a
4 ccsbBroadEn_06243 pDONR223 100% 92.3% 92.3% None (many diffs) n/a
5 ccsbBroad304_06243 pLX_304 0% 92.3% 92.3% V5 (many diffs) n/a
6 TRCN0000477872 CGCTTCTCACAGATCCAGCAAGTC pLX_317 31% 92.3% 92.3% V5 (many diffs) n/a
Download CSV