Construct: ORF TRCN0000477881
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF005068.1_s317c1
- Derived from:
- ccsbBroadEn_01996
- DNA Barcode:
- AACCAACCCAATCGCGCTCTTCGC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- B3GALT1 (8708)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000477881
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 8708 | B3GALT1 | beta-1,3-galactosyltransfer... | NM_020981.3 | 100% | 100% | |
| 2 | human | 8708 | B3GALT1 | beta-1,3-galactosyltransfer... | XM_005246931.3 | 100% | 100% | |
| 3 | human | 8708 | B3GALT1 | beta-1,3-galactosyltransfer... | XM_006712819.3 | 100% | 100% | |
| 4 | human | 8708 | B3GALT1 | beta-1,3-galactosyltransfer... | XM_011512085.2 | 100% | 100% | |
| 5 | mouse | 26877 | B3galt1 | UDP-Gal:betaGlcNAc beta 1,3... | NM_020283.4 | 90.5% | 100% | (many diffs) |
| 6 | mouse | 26877 | B3galt1 | UDP-Gal:betaGlcNAc beta 1,3... | XM_006499591.3 | 90.5% | 100% | (many diffs) |
| 7 | mouse | 26877 | B3galt1 | UDP-Gal:betaGlcNAc beta 1,3... | XM_011239571.2 | 90.5% | 100% | (many diffs) |
| 8 | mouse | 26877 | B3galt1 | UDP-Gal:betaGlcNAc beta 1,3... | XM_011239572.2 | 90.5% | 100% | (many diffs) |
| 9 | mouse | 26877 | B3galt1 | UDP-Gal:betaGlcNAc beta 1,3... | XM_011239573.2 | 90.5% | 100% | (many diffs) |
| 10 | mouse | 26877 | B3galt1 | UDP-Gal:betaGlcNAc beta 1,3... | XM_017318675.1 | 90.5% | 100% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1047
- ORF length:
- 978
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggcttcaaag gtctcctgtt tgtatgtttt gacagttgtg tgctgggcca 121 gcgctctctg gtacttgagt ataactcgcc ctacttcttc ttacactggc tccaaaccat 181 tcagccacct aacagttgcc aggaaaaact tcacctttgg caacataaga actcgaccta 241 tcaacccaca ttcttttgaa tttcttatca acgagcccaa taaatgtgag aaaaacattc 301 cttttcttgt tatcctcatc agcaccactc acaaggaatt tgatgcccgt caggcaatca 361 gagagacgtg gggggatgag aacaacttta aggggatcaa gatagccacc ctgttcctcc 421 tgggcaagaa tgctgatcct gttctcaatc agatggtgga gcaagagagc caaatcttcc 481 atgatatcat cgtggaggac tttattgact cctaccataa ccttaccctc aaaacattaa 541 tggggatgag atgggtggcc actttttgtt caaaagccaa gtatgtcatg aaaacagaca 601 gcgacatttt tgtaaacatg gacaatctta tttataaatt actgaaaccc tccaccaagc 661 cacgaagaag gtattttact ggcTATGTCA TTAATGGAGG ACCGATTCGG GATGTCCGCA 721 GTAAGTGGTA TATGCCCAGG GATTTGTACC CAGACAGTAA CTACCCACCT TTCTGTTCGG 781 GGACTGGCTA CATCTTTTCA GCCGATGTAG CTGAACTCAT TTACAAGACC TCACTCCACA 841 CAAGGCTGCT TCACCTTGAA GACGTATATG TGGGACTGTG TCTTCGAAAG CTGGGCATAC 901 ATCCTTTCCA GAACAGTGGC TTCAATCACT GGAAAATGGC CTACAGTTTG TGTAGGTATC 961 GCCGAGTTAT CACTGTGCAT CAGATCTCTC CAGAAGAAAT GCACAGAATC TGGAATGACA 1021 TGTCAAGCAA GAAACATCTC AGATGTTTGC CAACTTTCTT GTACAAAGTG GTTGATATCG 1081 GTAAGCCTAT CCCTAACCCT CTCCTCGGTC TCGATTCTAC GTAGTAATGA ACTAGTCCGT 1141 AACTTGAAAG TATTTCGATT TCTTGGCTTT ATATATCTTG TGGAAAGGAC GAAACCAACC 1201 CAATCGCGCT CTTCGCACGC GTTAAGTCga caatcaacct ctggattaca aaatttgtga 1261 aagatt