Construct: ORF TRCN0000477897
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF008620.1_s317c1
- Derived from:
- ccsbBroadEn_03901
- DNA Barcode:
- GGAATTGCTCGATTACGTCCAGAT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SRR (63826)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000477897
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 63826 | SRR | serine racemase | NM_021947.3 | 100% | 100% | |
| 2 | human | 63826 | SRR | serine racemase | XM_006721565.3 | 100% | 100% | |
| 3 | human | 63826 | SRR | serine racemase | XM_006721566.3 | 100% | 100% | |
| 4 | human | 63826 | SRR | serine racemase | XM_011523974.3 | 100% | 100% | |
| 5 | human | 63826 | SRR | serine racemase | NM_001304803.1 | 56.1% | 56.1% | 0_1ins447 |
| 6 | mouse | 27364 | Srr | serine racemase | NM_001163311.1 | 88.2% | 89.7% | (many diffs) |
| 7 | mouse | 27364 | Srr | serine racemase | NM_013761.4 | 88.2% | 89.7% | (many diffs) |
| 8 | mouse | 27364 | Srr | serine racemase | XM_006533457.3 | 88.2% | 89.7% | (many diffs) |
| 9 | mouse | 27364 | Srr | serine racemase | XM_017314569.1 | 88.2% | 89.7% | (many diffs) |
| 10 | mouse | 27364 | Srr | serine racemase | XM_017314570.1 | 88.2% | 89.7% | (many diffs) |
| 11 | mouse | 27364 | Srr | serine racemase | XM_017314571.1 | 88.2% | 89.7% | (many diffs) |
| 12 | mouse | 27364 | Srr | serine racemase | XM_011249056.2 | 74.1% | 69.9% | (many diffs) |
| 13 | mouse | 27364 | Srr | serine racemase | XM_011249057.2 | 73.9% | 72.3% | (many diffs) |
| 14 | mouse | 27364 | Srr | serine racemase | XM_017314572.1 | 71.5% | 71% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1089
- ORF length:
- 1020
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gtgtgctcag tattgcatct cctttgctga tgttgaaaaa gctcatatca 121 acattcgaga ttctatccac ctcacaccag tgctaacaag ctccattttg aatcaactaa 181 cagggcgcaa tcttttcttc aaatgtgaac tcttccagaa aacaggatct tttaagattc 241 gtggtgctct caatgccgtc agaagcttgg ttcctgatgc tttagaaagg aagccgaaag 301 ctgttgttac tcacagcagt ggaaaccatg gccaggctct cacctatgct gccaaattgg 361 aaggaattcc tgcttatatt gtggtgcccc agacagctcc agactgtaaa aaacttgcaa 421 tacaagccta cggagcgtca attgtatact gtgaacctag tgatgagtcc agagaaaatg 481 ttgcaaaaag agttacagaa gaaacagaag gcatcatggt acatcccaac caggagcctg 541 cagtgatagc tggacaaggg acaattgccc tggaagtgct gaaccaggtt cctttggtgg 601 atgcactggt ggtacctgta ggtggaggag gaatgcttgc tggaatagca attacagtta 661 aggctctgaa acctagtgtg aaggtatatg ctgctgaacc ctcaaatgca gatgactgct 721 accagtccaa gctgaagggg aaactgatgc ccaatcttta tcctccagaa accatagcag 781 atggtgtcaa atccagcatt ggcttgaaca cctggcctat tatcagggac cttgtggatg 841 atatcttcac tgtcacagag GATGAAATTA AGTGTGCAAC CCAGCTGGTG TGGGAGAGGA 901 TGAAACTACT CATTGAACCT ACAGCTGGTG TTGGAGTGGC TGCTGTGCTG TCTCAACATT 961 TTCAAACTGT TTCCCCAGAA GTAAAGAACA TTTGTATTGT GCTCAGTGGT GGAAATGTAG 1021 ACTTAACCTC CTCCATAACT TGGGTGAAGC AGGCTGAAAG GCCAGCTTCT TATCAGTCTG 1081 TTTCTGTTTT GCCAACTTTC TTGTACAAAG TGGTTGATAT CGGTAAGCCT ATCCCTAACC 1141 CTCTCCTCGG TCTCGATTCT ACGTAGTAAT GAACTAGTCC GTAACTTGAA AGTATTTCGA 1201 TTTCTTGGCT TTATATATCT TGTGGAAAGG ACGAGGAATT GCTCGATTAC GTCCAGATAC 1261 GCGTTAAGTC gacaatcaac ctctggatta caaaatttgt gaaagatt