Transcript: Human XM_006721566.3

PREDICTED: Homo sapiens serine racemase (SRR), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SRR (63826)
Length:
3706
CDS:
1290..2312

Additional Resources:

NCBI RefSeq record:
XM_006721566.3
NBCI Gene record:
SRR (63826)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006721566.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000163312 GCCCACACTTAACCTTGTCAA pLKO.1 3414 3UTR 100% 4.950 6.930 N SRR n/a
2 TRCN0000159000 GCTCATATCAACATTCGAGAT pLKO.1 1332 CDS 100% 4.050 5.670 N SRR n/a
3 TRCN0000292439 GCTCATATCAACATTCGAGAT pLKO_005 1332 CDS 100% 4.050 5.670 N SRR n/a
4 TRCN0000163152 GAATCAACTAACAGGGCGCAA pLKO.1 1391 CDS 100% 2.160 3.024 N SRR n/a
5 TRCN0000160385 CCAATCTTTATCCTCCAGAAA pLKO.1 1972 CDS 100% 4.950 3.465 N SRR n/a
6 TRCN0000292440 CCAATCTTTATCCTCCAGAAA pLKO_005 1972 CDS 100% 4.950 3.465 N SRR n/a
7 TRCN0000162458 CCAGCTTCTTATCAGTCTGTT pLKO.1 2283 CDS 100% 4.950 3.465 N SRR n/a
8 TRCN0000106627 CCAGTGCTAACAAGCTCCATT pLKO.1 1368 CDS 100% 4.950 3.465 N Srr n/a
9 TRCN0000162847 CCAGTGCTAACAAGCTCCATT pLKO.1 1368 CDS 100% 4.950 3.465 N SRR n/a
10 TRCN0000317628 CCAGTGCTAACAAGCTCCATT pLKO_005 1368 CDS 100% 4.950 3.465 N Srr n/a
11 TRCN0000162777 CCTAGTGATGAGTCCAGAGAA pLKO.1 1677 CDS 100% 4.950 3.465 N SRR n/a
12 TRCN0000292441 CCTAGTGATGAGTCCAGAGAA pLKO_005 1677 CDS 100% 4.950 3.465 N SRR n/a
13 TRCN0000160019 CCTCTTAGAATCAAACACATT pLKO.1 3015 3UTR 100% 4.950 3.465 N SRR n/a
14 TRCN0000161475 GCTTTAGAAAGGAAGCCGAAA pLKO.1 1500 CDS 100% 4.050 2.835 N SRR n/a
15 TRCN0000292514 GCTTTAGAAAGGAAGCCGAAA pLKO_005 1500 CDS 100% 4.050 2.835 N SRR n/a
16 TRCN0000163080 GCCAGCTTCTTATCAGTCTGT pLKO.1 2282 CDS 100% 2.640 1.848 N SRR n/a
17 TRCN0000161178 GAATGCTTGCTGGAATAGCAA pLKO.1 1852 CDS 100% 0.300 0.210 N SRR n/a
18 TRCN0000292438 GAATGCTTGCTGGAATAGCAA pLKO_005 1852 CDS 100% 0.300 0.210 N SRR n/a
19 TRCN0000241551 GATATTTGTTGGTGGCATTAA pLKO_005 1045 5UTR 100% 13.200 6.600 Y HNRNPA1L2 n/a
20 TRCN0000006586 AGATATTTGTTGGTGGCATTA pLKO.1 1044 5UTR 100% 10.800 5.400 Y HNRNPA1 n/a
21 TRCN0000293274 AGATATTTGTTGGTGGCATTA pLKO_005 1044 5UTR 100% 10.800 5.400 Y HNRNPA1 n/a
22 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 23 5UTR 100% 4.950 2.475 Y ERAP2 n/a
23 TRCN0000006585 TGTGGTAATGAGAGATCCAAA pLKO.1 856 5UTR 100% 4.950 2.475 Y HNRNPA1 n/a
24 TRCN0000140719 GATCACTTGAGGTCAGGAGTT pLKO.1 461 5UTR 100% 4.050 2.025 Y P3H4 n/a
25 TRCN0000165299 GATCACTTGAGGTCAGGAGTT pLKO.1 461 5UTR 100% 4.050 2.025 Y ORAI2 n/a
26 TRCN0000352971 GATCACTTGAGGTCAGGAGTT pLKO_005 461 5UTR 100% 4.050 2.025 Y P3H4 n/a
27 TRCN0000235095 ATATTTGTTGGTGGCATTAAA pLKO_005 1046 5UTR 100% 15.000 7.500 Y HNRNPA1 n/a
28 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 24 5UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006721566.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03901 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03901 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000477897 GGAATTGCTCGATTACGTCCAGAT pLX_317 22.9% 100% 100% V5 n/a
Download CSV