Construct: ORF TRCN0000477907
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF017185.1_s317c1
- Derived from:
- ccsbBroadEn_04655
- DNA Barcode:
- CGTACCCCGTACGAACCCTTGCAG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TRIM9 (114088)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000477907
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 114088 | TRIM9 | tripartite motif containing 9 | NM_052978.4 | 100% | 100% | |
| 2 | human | 114088 | TRIM9 | tripartite motif containing 9 | XM_017020950.1 | 82.6% | 74.2% | (many diffs) |
| 3 | human | 114088 | TRIM9 | tripartite motif containing 9 | XM_017020949.1 | 81.6% | 74.1% | (many diffs) |
| 4 | human | 114088 | TRIM9 | tripartite motif containing 9 | XM_017020947.1 | 78% | 77.4% | (many diffs) |
| 5 | human | 114088 | TRIM9 | tripartite motif containing 9 | XM_017020948.1 | 77.4% | 76.8% | (many diffs) |
| 6 | human | 114088 | TRIM9 | tripartite motif containing 9 | XM_005267302.3 | 76.2% | 75.3% | (many diffs) |
| 7 | human | 114088 | TRIM9 | tripartite motif containing 9 | NM_015163.5 | 76% | 75.4% | (many diffs) |
| 8 | human | 114088 | TRIM9 | tripartite motif containing 9 | XM_017020945.1 | 76% | 75.4% | (many diffs) |
| 9 | human | 114088 | TRIM9 | tripartite motif containing 9 | XM_017020946.1 | 75.5% | 74.9% | (many diffs) |
| 10 | human | 114088 | TRIM9 | tripartite motif containing 9 | XM_017020944.1 | 74.3% | 73.4% | (many diffs) |
| 11 | human | 114088 | TRIM9 | tripartite motif containing 9 | XM_005267301.3 | 70% | 69.4% | (many diffs) |
| 12 | human | 114088 | TRIM9 | tripartite motif containing 9 | XM_006720018.3 | 68.4% | 67.9% | (many diffs) |
| 13 | human | 114088 | TRIM9 | tripartite motif containing 9 | XM_017020943.1 | 67.9% | 67.4% | (many diffs) |
| 14 | human | 114088 | TRIM9 | tripartite motif containing 9 | XM_011536389.2 | 67% | 66.5% | (many diffs) |
| 15 | human | 114088 | TRIM9 | tripartite motif containing 9 | XR_002957527.1 | 38.6% | (many diffs) | |
| 16 | human | 114088 | TRIM9 | tripartite motif containing 9 | XR_001750136.1 | 27.4% | (many diffs) | |
| 17 | human | 114088 | TRIM9 | tripartite motif containing 9 | XR_001750135.1 | 25.6% | (many diffs) | |
| 18 | human | 114088 | TRIM9 | tripartite motif containing 9 | XR_002957528.1 | 25.5% | (many diffs) | |
| 19 | mouse | 94090 | Trim9 | tripartite motif-containing 9 | XM_006516407.3 | 89.6% | 96.3% | (many diffs) |
| 20 | mouse | 94090 | Trim9 | tripartite motif-containing 9 | NM_001110203.1 | 89% | 96.1% | (many diffs) |
| 21 | mouse | 94090 | Trim9 | tripartite motif-containing 9 | NM_001286386.1 | 88.7% | 96.1% | (many diffs) |
| 22 | mouse | 94090 | Trim9 | tripartite motif-containing 9 | XM_006516406.3 | 87% | 93.9% | (many diffs) |
| 23 | mouse | 94090 | Trim9 | tripartite motif-containing 9 | XM_006516405.3 | 69.2% | 74.6% | (many diffs) |
| 24 | mouse | 94090 | Trim9 | tripartite motif-containing 9 | NM_001110202.1 | 68.4% | 74.6% | (many diffs) |
| 25 | mouse | 94090 | Trim9 | tripartite motif-containing 9 | XM_006516404.3 | 67.7% | 73.4% | (many diffs) |
| 26 | mouse | 94090 | Trim9 | tripartite motif-containing 9 | XM_006516403.3 | 66.7% | 72.8% | (many diffs) |
| 27 | mouse | 94090 | Trim9 | tripartite motif-containing 9 | XM_006516402.3 | 66.6% | 71.1% | (many diffs) |
| 28 | mouse | 94090 | Trim9 | tripartite motif-containing 9 | XM_017315265.1 | 66.3% | 70.9% | (many diffs) |
| 29 | mouse | 94090 | Trim9 | tripartite motif-containing 9 | XM_017315264.1 | 63.5% | 68.6% | (many diffs) |
| 30 | mouse | 94090 | Trim9 | tripartite motif-containing 9 | NM_001286387.1 | 62.8% | 67.9% | (many diffs) |
| 31 | mouse | 94090 | Trim9 | tripartite motif-containing 9 | NM_053167.3 | 62.7% | 67.7% | (many diffs) |
| 32 | mouse | 94090 | Trim9 | tripartite motif-containing 9 | XM_006516401.3 | 62.4% | 67.1% | (many diffs) |
| 33 | mouse | 94090 | Trim9 | tripartite motif-containing 9 | XM_017315263.1 | 61.9% | 66.9% | (many diffs) |
| 34 | mouse | 94090 | Trim9 | tripartite motif-containing 9 | XM_006516400.3 | 61.4% | 66.4% | (many diffs) |
| 35 | mouse | 94090 | Trim9 | tripartite motif-containing 9 | NM_001286388.1 | 61.3% | 66.2% | (many diffs) |
| 36 | mouse | 94090 | Trim9 | tripartite motif-containing 9 | XR_381560.3 | 14.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1716
- ORF length:
- 1650
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga ggagatggaa gaggagttga aatgccccgt gtgcggctcc ttctatcggg 121 agcccatcat cctgccctgc tctcacaatt tgtgtcaggc gtgcgcccgc aacatcctgg 181 tgcagacccc agagtctgaa tccccccaga gccatcgggc cgcgggctcc ggggtctccg 241 actatgacta tctggacctg gacaagatga gcctatacag cgaggcggac agcggctatg 301 gctcctacgg ggggttcgcc agcgccccca ctaccccgtg ccagaagtcc cccaacggcg 361 tccgcgtgtt tcccccggct atgccgccac cggccaccca cttgtcaccg gccctggccc 421 cggtgccccg caactcctgt atcacctgcc cccagtgtca ccgcagcctc atcctggatg 481 accgggggct ccgcggcttc cccaagaatc gcgtactgga aggggtaatt gaccgctacc 541 agcagagcaa agccgcggcc ctcaagtgcc agctctgcga gaaggcgccc aaggaagcca 601 ccgtcatgtg cgaacagtgc gatgtcttct actgcgatcc gtgccgcctg cgctgccacc 661 cgccccgggg gcccctagcc aagcaccgcc tggtgccccc ggcccagggt cgtgtgagcc 721 ggaggctgag cccacgcaag gtctccacct gcacagacca cgagctggag aaccacagca 781 tgtactgcgt gcaatgcaag atgcccgtgt gctaccagtg cttggaggag ggcaaacact 841 ccagccacga agtcaaggct ctgggggcca tgtggaaact acataagagc cagctctccc 901 aggcgctgaa cggactgtca gacagggcca aagaagccaa ggagtttctg gtacagctgc 961 gcaacatggt ccagcagatc caggagaaca gtgtggagtt tgaagcctgt ctggtggccc 1021 aatgtgatgc cctcatcgat gccctcaaca gaagaaaagc ccagctgctg gcccgcgtca 1081 acaaggagca tgagcacaag ctgaaggtgg ttcgagatca gatctctcac tgcacagtga 1141 aattgcgcca gaccacaggt ctcatggagt actgcttgga ggtgattaag gaaaatgatc 1201 ctagtggttt tttgcagatt tctgacgccc tcataagaag agtgcacctg actgaggatc 1261 agtggggtaa aggcacactc actccaagga tgaccacgga ctttgacttg agtctggaca 1321 acagccctct gctgcaatcc atccaccagc tggatttcgt gcaagtgaaa gcttcctctc 1381 cagtcccagc aacccctatc ctacagctgg aggaatgttg tacccacaaC AACAGCGCTA 1441 CGTTGTCCTG GAAACAGCCA CCTCTGTCCA CGGTGCCCGC CGATGGATAC ATTCTGGAGC 1501 TGGATGATGG CAACGGTGGT CAATTCCGGG AGGTGTATGT GGGGAAGGAG ACAATGTGCA 1561 CTGTGGATGG TCTTCACTTC AACAGCACAT ACAACGCTCG GGTCAAGGCC TTCAACAAAA 1621 CAGGAGTCAG CCCGTACAGC AAGACCCTGG TCCTCCAAAC GTCTGAGGGT AAGGCCCTTC 1681 AGCAGTATCC CTCAGAGCGA GAACTGCGTG GCATCTACCC AACTTTCTTG TACAAAGTGG 1741 TTGATATCGG TAAGCCTATC CCTAACCCTC TCCTCGGTCT CGATTCTACG TAGTAATGAA 1801 CTAGTCCGTA ACTTGAAAGT ATTTCGATTT CTTGGCTTTA TATATCTTGT GGAAAGGACG 1861 ACGTACCCCG TACGAACCCT TGCAGACGCG TTAAGTCgac aatcaacctc tggattacaa 1921 aatttgtgaa agatt