Transcript: Human NM_052978.4

Homo sapiens tripartite motif containing 9 (TRIM9), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
TRIM9 (114088)
Length:
4393
CDS:
766..2418

Additional Resources:

NCBI RefSeq record:
NM_052978.4
NBCI Gene record:
TRIM9 (114088)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_052978.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000436821 GGGTCTCCGACTATGACTATC pLKO_005 932 CDS 100% 10.800 15.120 N TRIM9 n/a
2 TRCN0000420227 AGATTTCTGACGCCCTCATAA pLKO_005 1916 CDS 100% 13.200 9.240 N TRIM9 n/a
3 TRCN0000422638 TGATGGCAACGGTGGTCAATT pLKO_005 2205 CDS 100% 13.200 9.240 N TRIM9 n/a
4 TRCN0000034069 CCTGGACAAGATGAGCCTATA pLKO.1 957 CDS 100% 10.800 7.560 N TRIM9 n/a
5 TRCN0000034070 CGATGCCCTCAACAGAAGAAA pLKO.1 1737 CDS 100% 5.625 3.938 N TRIM9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_052978.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04655 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04655 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000477907 CGTACCCCGTACGAACCCTTGCAG pLX_317 17.7% 100% 100% V5 n/a
Download CSV