Transcript: Mouse NM_001286387.1

Mus musculus tripartite motif-containing 9 (Trim9), transcript variant 5, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Trim9 (94090)
Length:
4677
CDS:
447..2810

Additional Resources:

NCBI RefSeq record:
NM_001286387.1
NBCI Gene record:
Trim9 (94090)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001286387.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000039497 CGGGTCAACAAGGAGCATGAA pLKO.1 1455 CDS 100% 4.950 6.930 N Trim9 n/a
2 TRCN0000039498 CGCATCGATGTGATGAAGGAT pLKO.1 2529 CDS 100% 3.000 2.400 N Trim9 n/a
3 TRCN0000039496 GCTGAGTTTGCATTCTTCTTT pLKO.1 2228 CDS 100% 5.625 3.938 N Trim9 n/a
4 TRCN0000039495 CCGGGAAGTGTATGTTGGAAA pLKO.1 1907 CDS 100% 4.950 3.465 N Trim9 n/a
5 TRCN0000039494 CGACTTAAACAGAAAGACATT pLKO.1 2630 CDS 100% 4.950 3.465 N Trim9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001286387.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04655 pDONR223 100% 62.8% 67.9% None (many diffs) n/a
2 ccsbBroad304_04655 pLX_304 0% 62.8% 67.9% V5 (many diffs) n/a
3 TRCN0000477907 CGTACCCCGTACGAACCCTTGCAG pLX_317 17.7% 62.8% 67.9% V5 (many diffs) n/a
Download CSV