Construct: ORF TRCN0000477924
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF011364.1_s317c1
- Derived from:
- ccsbBroadEn_00891
- DNA Barcode:
- TTTCCGCGAACTCTCCGGGCACGC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- KCNA6 (3742)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000477924
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 3742 | KCNA6 | potassium voltage-gated cha... | NM_002235.3 | 100% | 100% | |
| 2 | human | 3742 | KCNA6 | potassium voltage-gated cha... | XM_005253686.3 | 100% | 100% | |
| 3 | human | 3742 | KCNA6 | potassium voltage-gated cha... | XM_011520955.2 | 100% | 100% | |
| 4 | human | 3742 | KCNA6 | potassium voltage-gated cha... | XM_017019270.1 | 100% | 100% | |
| 5 | human | 3742 | KCNA6 | potassium voltage-gated cha... | XM_017019271.1 | 100% | 100% | |
| 6 | human | 3742 | KCNA6 | potassium voltage-gated cha... | XM_017019272.1 | 100% | 100% | |
| 7 | mouse | 16494 | Kcna6 | potassium voltage-gated cha... | NM_013568.6 | 86% | 92.8% | (many diffs) |
| 8 | mouse | 16494 | Kcna6 | potassium voltage-gated cha... | XM_006505638.3 | 86% | 92.8% | (many diffs) |
| 9 | mouse | 16494 | Kcna6 | potassium voltage-gated cha... | XM_006505639.3 | 86% | 92.8% | (many diffs) |
| 10 | mouse | 16494 | Kcna6 | potassium voltage-gated cha... | XM_011241228.2 | 86% | 92.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1653
- ORF length:
- 1587
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgag atcggagaaa tcccttacgc tggcggcgcc gggggaggtc cgtgggccgg 121 agggagagca acaggatgcg ggagacttcc cggaggccgg cgggggcggg ggctgctgta 181 gtagcgagcg gctggtgatc aatatctccg ggctgcgctt tgagacacaa ttgcgcaccc 241 tgtcgctgtt tccggacacg ctgctcggag accctggccg gcgagtccgc ttcttcgacc 301 ccctgaggaa cgagtacttc ttcgaccgca accggcccag cttcgacgcc atcctctact 361 actaccagtc tgggggccgc ctgcggaggc cggtcaacgt gcccctggac attttcctgg 421 aggagatccg cttctaccag ctgggggacg aggccctggc ggccttccgg gaggacgagg 481 gctgcctgcc cgaaggtggc gaggacgaga agccgctgcc ctcccagccc ttccagcgcc 541 aggtgtggct gctctttgag tacccagaga gctctgggcc ggccaggggc atcgccatcg 601 tctccgtgtt ggtcattctc atctccatag tcatcttttg cctggagacc ttaccccagt 661 tccgtgtaga tggtcgaggt ggaaacaatg gtggtgtgag tcgagtctcc ccagtttcca 721 gggggagtca ggaggaagag gaggatgaag acgattccta cacatttcat catggcatca 781 cccctgggga aatggggacc gggggctcct cctcactcag tactcttggg ggctccttct 841 ttacagaccc cttctttctg gtggagacgc tgtgcattgt ctggttcact tttgagctcc 901 tggtgcgctt ctccgcctgc cctagcaagc cggccttctt ccggaacatc atgaacatca 961 ttgacttggt ggctatcttc ccctacttca tcaccctggg cactgagctg gtgcagcagc 1021 aggagcagca accagccagt ggaggaggcg gccagaatgg gcagcaggcc atgtccctgg 1081 ccatcctccg agtcatccgc ctggtccggg tgttccgcat cttcaagctc tcccgccact 1141 ccaaggggct gcagatcctg ggcaagacct tgcaggcctc catgagggag ctggggctgc 1201 TCATCTTCTT CCTCTTCATC GGGGTCATCC TCTTCTCCAG TGCCGTCTAC TTCGCAGAGG 1261 CTGACGATGA CGATTCGCTT TTTCCCAGCA TCCCGGATGC CTTCTGGTGG GCAGTGGTTA 1321 CAATGACCAC GGTAGGTTAC GGGGACATGT ACCCCATGAC TGTGGGGGGA AAGATCGTGG 1381 GCTCGCTGTG TGCCATCGCT GGGGTCCTCA CCATTGCCCT GCCTGTGCCC GTCATCGTCT 1441 CCAACTTCAA CTACTTCTAC CACCGGGAGA CGGAGCAGGA GGAGCAAGGC CAGTATACCC 1501 ACGTCACTTG TGGGCAGCCT GCGCCGGACC TGAGGGCAAC TGACAACGGA CTTGGCAAGC 1561 CTGACTTCCC CGAGGCTAAC CGGGAACGGA GACCCAGCTA CCTTCCTACA CCACATCGGG 1621 CCTATGCAGA GAAAAGAATG CTCACGGAGG TCTGCCCAAC TTTCTTGTAC AAAGTGGTTG 1681 ATATCGGTAA GCCTATCCCT AACCCTCTCC TCGGTCTCGA TTCTACGTAG TAATGAACTA 1741 GTCCGTAACT TGAAAGTATT TCGATTTCTT GGCTTTATAT ATCTTGTGGA AAGGACGATT 1801 TCCGCGAACT CTCCGGGCAC GCACGCGTTA AGTCgacaat caacctctgg attacaaaat 1861 ttgtgaaaga tt