Transcript: Mouse XM_006505638.3

PREDICTED: Mus musculus potassium voltage-gated channel, shaker-related, subfamily, member 6 (Kcna6), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Kcna6 (16494)
Length:
6187
CDS:
992..2581

Additional Resources:

NCBI RefSeq record:
XM_006505638.3
NBCI Gene record:
Kcna6 (16494)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006505638.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000427146 ACAATGACCACGGTAGGTTAT pLKO_005 2246 CDS 100% 10.800 15.120 N Kcna6 n/a
2 TRCN0000069276 CGGCCTTCTTTCGCAATATCA pLKO.1 1857 CDS 100% 5.625 7.875 N Kcna6 n/a
3 TRCN0000069274 CATCGAGCTTATGCGGAGAAA pLKO.1 2540 CDS 100% 4.950 6.930 N Kcna6 n/a
4 TRCN0000069277 CGTCTCAGTATTGGTCATCCT pLKO.1 1525 CDS 100% 2.640 3.696 N Kcna6 n/a
5 TRCN0000420483 ACGCTATCCTTTATTACTATC pLKO_005 1272 CDS 100% 10.800 7.560 N Kcna6 n/a
6 TRCN0000069273 CCACCCATTAAATGAGAACAT pLKO.1 4205 3UTR 100% 4.950 3.465 N Kcna6 n/a
7 TRCN0000069275 CTGCTGTAGTAGTGAGAGGTT pLKO.1 1099 CDS 100% 2.640 1.848 N Kcna6 n/a
8 TRCN0000416484 ATGGTGACACCAGTAGAATAG pLKO_005 2914 3UTR 100% 10.800 6.480 N Kcna6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006505638.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00891 pDONR223 100% 86% 92.8% None (many diffs) n/a
2 ccsbBroad304_00891 pLX_304 0% 86% 92.8% V5 (many diffs) n/a
3 TRCN0000477924 TTTCCGCGAACTCTCCGGGCACGC pLX_317 28.8% 86% 92.8% V5 (many diffs) n/a
Download CSV