Transcript: Human NM_002235.3

Homo sapiens potassium voltage-gated channel subfamily A member 6 (KCNA6), mRNA.

Source:
NCBI, updated 2019-05-04
Taxon:
Homo sapiens (human)
Gene:
KCNA6 (3742)
Length:
5982
CDS:
867..2456

Additional Resources:

NCBI RefSeq record:
NM_002235.3
NBCI Gene record:
KCNA6 (3742)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002235.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000044206 CTGACGATGACGATTCGCTTT pLKO.1 2062 CDS 100% 4.050 5.670 N KCNA6 n/a
2 TRCN0000429735 CTATCAACCTTGTTGCTTAAT pLKO_005 2606 3UTR 100% 13.200 9.240 N KCNA6 n/a
3 TRCN0000044205 GAAGACGATTCCTACACATTT pLKO.1 1548 CDS 100% 13.200 9.240 N KCNA6 n/a
4 TRCN0000044203 GCTGCGCTTTGAGACACAATT pLKO.1 1013 CDS 100% 13.200 9.240 N KCNA6 n/a
5 TRCN0000416824 TAATCCATCTAAGTGACATTT pLKO_005 2645 3UTR 100% 13.200 9.240 N KCNA6 n/a
6 TRCN0000415306 CATTGACTTGGTGGCTATCTT pLKO_005 1760 CDS 100% 5.625 3.938 N KCNA6 n/a
7 TRCN0000044204 GTGCATTGTCTGGTTCACTTT pLKO.1 1673 CDS 100% 4.950 3.465 N KCNA6 n/a
8 TRCN0000044207 AGCTACCTTCCTACACCACAT pLKO.1 2397 CDS 100% 4.050 2.835 N KCNA6 n/a
9 TRCN0000069191 CGACGCCATCCTCTACTACTA pLKO.1 1145 CDS 100% 4.950 2.475 Y Kcna3 n/a
10 TRCN0000427146 ACAATGACCACGGTAGGTTAT pLKO_005 2121 CDS 100% 10.800 7.560 N Kcna6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002235.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00891 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00891 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000477924 TTTCCGCGAACTCTCCGGGCACGC pLX_317 28.8% 100% 100% V5 n/a
Download CSV