Construct: ORF TRCN0000477947
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF007043.1_s317c1
- Derived from:
- ccsbBroadEn_03389
- DNA Barcode:
- TAACCAACGCGGCAACTAACCGGT
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TPCN1 (53373)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000477947
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 53373 | TPCN1 | two pore segment channel 1 | NM_017901.6 | 100% | 100% | |
| 2 | human | 53373 | TPCN1 | two pore segment channel 1 | XM_011538492.2 | 100% | 100% | |
| 3 | human | 53373 | TPCN1 | two pore segment channel 1 | NM_001143819.3 | 91.8% | 91.8% | 1_216del |
| 4 | human | 53373 | TPCN1 | two pore segment channel 1 | XM_011538490.2 | 91.8% | 91.8% | 1_216del |
| 5 | human | 53373 | TPCN1 | two pore segment channel 1 | NM_001301214.1 | 91.6% | 91.6% | 0_1ins204 |
| 6 | human | 53373 | TPCN1 | two pore segment channel 1 | NM_001351346.2 | 91.6% | 91.6% | 0_1ins204 |
| 7 | human | 53373 | TPCN1 | two pore segment channel 1 | NM_001351347.1 | 91.6% | 91.6% | 0_1ins204 |
| 8 | human | 53373 | TPCN1 | two pore segment channel 1 | XM_011538493.2 | 91.6% | 91.6% | 0_1ins204 |
| 9 | human | 53373 | TPCN1 | two pore segment channel 1 | XM_017019480.2 | 89.8% | 89.7% | 1_216del;1615_1616ins54 |
| 10 | human | 53373 | TPCN1 | two pore segment channel 1 | XR_001748766.2 | 64.7% | (many diffs) | |
| 11 | human | 53373 | TPCN1 | two pore segment channel 1 | XM_017019482.2 | 64% | 63.9% | 1_216del;1923_1923delGins742 |
| 12 | human | 53373 | TPCN1 | two pore segment channel 1 | XR_001748767.2 | 63% | (many diffs) | |
| 13 | human | 53373 | TPCN1 | two pore segment channel 1 | XR_001748765.2 | 44.4% | 1_385del;2089_2249del;2995_5510del | |
| 14 | mouse | 252972 | Tpcn1 | two pore channel 1 | NM_145853.2 | 86.8% | 90.9% | (many diffs) |
| 15 | mouse | 252972 | Tpcn1 | two pore channel 1 | XM_011248201.2 | 86.8% | 90.9% | (many diffs) |
| 16 | mouse | 252972 | Tpcn1 | two pore channel 1 | XR_387565.3 | 59.1% | (many diffs) | |
| 17 | mouse | 252972 | Tpcn1 | two pore channel 1 | XR_387566.3 | 44.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 2517
- ORF length:
- 2448
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggctgtgagt ttggatgacg acgtgccgct catcctgacc ttggatgagg 121 gtggcagtgc cccactggct ccctccaacg gcctgggcca agaagagcta cctagcaaaa 181 atggcggcag ctatgccatc cacgactccc aggcccccag tctcagctct gggggtgaga 241 gttccccctc cagccccgca cacaactggg agatgaatta ccaagaggca gcaatctacc 301 tccaggaagg cgagaacaac gacaagttct tcacccaccc caaggatgcc aaggcgctgg 361 cggcctacct ctttgcacac aatcacctct tctacctgat ggagctggcc acggccctgc 421 tgctgctgct gctctccctg tgcgaggccc ccgccgtccc cgcactccgg cttggcatct 481 atgtccacgc caccctggag ctgtttgccc tgatggtggt agtgtttgaa ctctgcatga 541 agttacgctg gctgggcctc cacaccttca tccggcacaa gcggaccatg gtcaagacct 601 cggtgctggt ggtgcagttt gtcgaggcca tcgtggtgtt ggtacggcag atgtcccatg 661 tgcgggtgac ccgagcactg cgctgcattt tcctggtgga ctgtcggtat tgcggtggcg 721 tccggcgcaa cctgcggcag atcttccagt ccctgccgcc cttcatggac atcctcctgc 781 tgctgctgtt cttcatgatc atctttgcca tcctcggttt ctacttgttc tcccctaacc 841 cttcagaccc ctacttcagc accctggaga acagcatcgt cagtctgttt gtccttctga 901 ccacagccaa tttcccagat gtgatgatgc cctcctactc ccggaacccc tggtcctgcg 961 tcttcttcat cgtgtacctc tccatcgagc tgtatttcat catgaacctg cttctggctg 1021 tggtgttcga caccttcaat gacattgaga aacgcaagtt caagtctttg ctactgcaca 1081 agcgaaccgc tatccagcat gcctaccgcc tgctcatcag ccagaggagg cctgccggca 1141 tctcctacag gcagtttgaa ggcctcatgc gcttctacaa gccccggatg agtgccaggg 1201 agcgctatct taccttcaag gccctgaatc agaacaacac acccctgctc agcctaaagg 1261 acttttacga tatctacgaa gttgctgctt tgaagtggaa ggccaagaaa aacagagagc 1321 actggtttga tgagcttccc aggacggcgc tcctcatctt caaaggtatt aatatccttg 1381 tgaagtccaa ggccttccag tatttcatgt acttggtggt ggcagtcaac ggggtctgga 1441 tcctcgtgga gacatttatg ctgaaaggtg ggaacttctt ctccaagcac gtgccctgga 1501 gttacctcgt ctttctaact atctatgggg tggagctgtt cctgaaggtt gccggcctgg 1561 gccctgtgga gtacttgtct tccggatgga acttgtttga cttctccgtg acagtgttcg 1621 ccttcctggg actgctggcg ctggccctca acatggagcc cttctatttc atcgtggtcc 1681 tgcgccccct ccagctgctg aggttgttta agttgaagga gcgctaccgc aacgtgctgg 1741 acaccatgtt cgagctgctg ccccggatgg ccagcctggg cctcaccctg ctcatctttt 1801 actactcctt cgccatcgtg ggcatggagt tcttctgcgg gatcgtcttc cccaactgct 1861 gcaacacgag tacagtggca gatgcctacc gctggcgcaa ccacaccgtg ggcaacagga 1921 ccgtggtgga ggaaggctac tattatctca ataattttga caacatcctc aacagctttg 1981 tgaccctgtt tgagctcaca gttgtcaaca actggtacat catcatggaa ggcgtcacct 2041 ctcagacctc ccactggagc cgcctctact tcatgacctt ttacattgtg accatggtgg 2101 tgatgacgat cattgtcgcc tttatcctcg aggccttcgt cttccgaatg aactacagcc 2161 gcaagaacca ggactcggaa gttgatggtg gcatcaccct tgagaaggaa atctccaaag 2221 aagagctggt tgccgtcctg gagctctacc gggaggcacg gggggcctcc tcggatgtca 2281 ccaggctgct ggagaccctc tcccagatgg agagatacca gcaacattcc atggtgtttc 2341 TGGGACGGCG ATCAAGGACC AAGAGCGACC TGAGCCTGAA GATGTACCAG GAGGAGATCC 2401 AGGAGTGGTA TGAGGAGCAT GCCAGGGAGC AAGAGCAGCA GCGACAACTC AGCAGCAGTG 2461 CAGCCCCCGC CGCCCAGCAG CCCCCAGGCA GCCGCCAGCG CTCCCAGACC GTTACCTTTG 2521 CCAACTTTCT TGTACAAAGT GGTTGATATC GGTAAGCCTA TCCCTAACCC TCTCCTCGGT 2581 CTCGATTCTA CGTAGTAATG AACTAGTCCG TAACTTGAAA GTATTTCGAT TTCTTGGCTT 2641 TATATATCTT GTGGAAAGGA CGATAACCAA CGCGGCAACT AACCGGTACG CGTTAAGTCg 2701 acaatcaacc tctggattac aaaatttgtg aaagatt