Transcript: Human NM_001301214.1

Homo sapiens two pore segment channel 1 (TPCN1), transcript variant 3, mRNA.

Source:
NCBI, updated 2018-12-16
Taxon:
Homo sapiens (human)
Gene:
TPCN1 (53373)
Length:
5071
CDS:
194..2440

Additional Resources:

NCBI RefSeq record:
NM_001301214.1
NBCI Gene record:
TPCN1 (53373)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001301214.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000005041 CGCCTCTACTTCATGACCTTT pLKO.1 1982 CDS 100% 4.950 6.930 N TPCN1 n/a
2 TRCN0000005043 CGTGGAGACATTTATGCTGAA pLKO.1 1366 CDS 100% 4.050 5.670 N TPCN1 n/a
3 TRCN0000335814 GACGATCATTGTCGCCTTTAT pLKO_005 2026 CDS 100% 13.200 10.560 N TPCN1 n/a
4 TRCN0000005042 GCCTACCTCTTTGCACACAAT pLKO.1 284 CDS 100% 4.950 3.960 N TPCN1 n/a
5 TRCN0000335961 GCCTACCTCTTTGCACACAAT pLKO_005 284 CDS 100% 4.950 3.960 N TPCN1 n/a
6 TRCN0000369055 CTCATCTTCAAAGGTATTAAT pLKO_005 1274 CDS 100% 15.000 10.500 N TPCN1 n/a
7 TRCN0000369111 GTACACATACTCACGTATATG pLKO_005 2520 3UTR 100% 13.200 9.240 N TPCN1 n/a
8 TRCN0000005040 CGGATGGAACTTGTTTGACTT pLKO.1 1504 CDS 100% 4.950 3.465 N TPCN1 n/a
9 TRCN0000005044 GCTGAGGTTGTTTAAGTTGAA pLKO.1 1618 CDS 100% 4.950 3.465 N TPCN1 n/a
10 TRCN0000335898 GCTGAGGTTGTTTAAGTTGAA pLKO_005 1618 CDS 100% 4.950 3.465 N TPCN1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001301214.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03389 pDONR223 100% 91.6% 91.6% None 0_1ins204 n/a
2 ccsbBroad304_03389 pLX_304 0% 91.6% 91.6% V5 0_1ins204 n/a
3 TRCN0000477947 TAACCAACGCGGCAACTAACCGGT pLX_317 7.6% 91.6% 91.6% V5 (not translated due to prior stop codon) 0_1ins204 n/a
Download CSV