Transcript: Mouse XM_011248201.2

PREDICTED: Mus musculus two pore channel 1 (Tpcn1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tpcn1 (252972)
Length:
4747
CDS:
343..2796

Additional Resources:

NCBI RefSeq record:
XM_011248201.2
NBCI Gene record:
Tpcn1 (252972)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011248201.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000069995 CGAAGGCTTAATGCGCTTCTA pLKO.1 1434 CDS 100% 4.950 6.930 N Tpcn1 n/a
2 TRCN0000316944 CGAAGGCTTAATGCGCTTCTA pLKO_005 1434 CDS 100% 4.950 6.930 N Tpcn1 n/a
3 TRCN0000069993 GCTCCAGAAATAACCAGCTTA pLKO.1 2972 3UTR 100% 4.950 6.930 N Tpcn1 n/a
4 TRCN0000316943 GCTCCAGAAATAACCAGCTTA pLKO_005 2972 3UTR 100% 4.950 6.930 N Tpcn1 n/a
5 TRCN0000069996 GCTCACCTTCTACTATTCCTT pLKO.1 2067 CDS 100% 3.000 4.200 N Tpcn1 n/a
6 TRCN0000316945 GCTCACCTTCTACTATTCCTT pLKO_005 2067 CDS 100% 3.000 4.200 N Tpcn1 n/a
7 TRCN0000069997 CCACAACCACTTCTTCTACAT pLKO.1 654 CDS 100% 4.950 3.960 N Tpcn1 n/a
8 TRCN0000316946 CCACAACCACTTCTTCTACAT pLKO_005 654 CDS 100% 4.950 3.960 N Tpcn1 n/a
9 TRCN0000069994 CGCCTGTACTTCATGACCTTT pLKO.1 2338 CDS 100% 4.950 3.465 N Tpcn1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011248201.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03389 pDONR223 100% 86.8% 90.9% None (many diffs) n/a
2 ccsbBroad304_03389 pLX_304 0% 86.8% 90.9% V5 (many diffs) n/a
3 TRCN0000477947 TAACCAACGCGGCAACTAACCGGT pLX_317 7.6% 86.8% 90.9% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV