Construct: ORF TRCN0000478023
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF002760.1_s317c1
- Derived from:
- ccsbBroadEn_09064
- DNA Barcode:
- TGTTAACAGTCACGTCTTACTGTC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- GPR63 (81491)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000478023
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 81491 | GPR63 | G protein-coupled receptor 63 | NM_001143957.3 | 99.9% | 100% | 42A>T |
2 | human | 81491 | GPR63 | G protein-coupled receptor 63 | NM_030784.4 | 99.9% | 100% | 42A>T |
3 | human | 81491 | GPR63 | G protein-coupled receptor 63 | XM_006715570.4 | 99.9% | 100% | 42A>T |
4 | human | 81491 | GPR63 | G protein-coupled receptor 63 | XM_011536153.2 | 99.9% | 100% | 42A>T |
5 | human | 81491 | GPR63 | G protein-coupled receptor 63 | XM_011536154.2 | 99.9% | 100% | 42A>T |
6 | human | 81491 | GPR63 | G protein-coupled receptor 63 | XM_011536155.2 | 99.9% | 100% | 42A>T |
7 | human | 81491 | GPR63 | G protein-coupled receptor 63 | XM_011536157.2 | 99.9% | 100% | 42A>T |
8 | human | 81491 | GPR63 | G protein-coupled receptor 63 | XM_011536159.2 | 99.9% | 100% | 42A>T |
9 | human | 81491 | GPR63 | G protein-coupled receptor 63 | XM_017011334.1 | 99.9% | 100% | 42A>T |
10 | mouse | 81006 | Gpr63 | G protein-coupled receptor 63 | NM_030733.3 | 86.2% | 91% | (many diffs) |
11 | mouse | 81006 | Gpr63 | G protein-coupled receptor 63 | XM_006538382.3 | 86.2% | 91% | (many diffs) |
12 | mouse | 81006 | Gpr63 | G protein-coupled receptor 63 | XM_006538383.3 | 86.2% | 91% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1326
- ORF length:
- 1257
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggtcttctcg gcagtgttga ctgcgttcca taccgggact tccaacacaa 121 catttgtcgt gtatgaaaac acctacatga atattacact ccctccacca ttccagcatc 181 ctgacctcag tccattgctt agatatagtt ttgaaaccat ggctcccact ggtttgagtt 241 ccttgaccgt gaatagtaca gctgtgccca caacaccagc agcatttaag agcctaaact 301 tgcctcttca gatcaccctt tctgctataa tgatattcat tctgtttgtg tcttttcttg 361 ggaacttggt tgtttgcctc atggtttacc aaaaagctgc catgaggtct gcaattaaca 421 tcctccttgc cagcctagct tttgcagaca tgttgcttgc agtgctgaac atgccctttg 481 ccctggtaac tattcttact acccgatgga tttttgggaa attcttctgt agggtatctg 541 ctatgttttt ctggttattt gtgatagaag gagtagccat cctgctcatc attagcatag 601 ataggttcct tattatagtc cagaggcagg ataagctaaa cccatataga gctaaggttc 661 tgattgcagt ttcttgggca acttcctttt gtgtagcttt tcctttagcc gtaggaaacc 721 ccgacctgca gataccttcc cgagctcccc agtgtgtgtt tgggtacaca accaatccag 781 gctaccaggc ttatgtgatt ttgatttctc tcatttcttt cttcataccc ttcctggtaa 841 tactgtactc atttatgggc atactcaaca cccttcggca caatgccttg aggatccata 901 gctaccctga aggtatatgc ctcagccagg ccagcaaact gggtctcatg agtctgcaga 961 gacctttcca gatgagcatt gacatgggct ttaaaacacg tgccttcacc actattttga 1021 ttctctttgc tgtcttcatt gtctgctggg ccccattcac cacttacagc cttgtggcaa 1081 cattcagtaa gcacttttac tatcagcaca acttttttga gattagcacc tgGCTACTGT 1141 GGCTCTGCTA CCTCAAGTCT GCATTGAATC CGCTGATCTA CTACTGGAGG ATTAAGAAAT 1201 TCCATGATGC TTGCCTGGAC ATGATGCCTA AGTCCTTCAA GTTTTTGCCG CAGCTCCCTG 1261 GTCACACAAA GCGACGGATA CGTCCTAGTG CTGTCTATGT GTGTGGGGAA CATCGGACGG 1321 TGGTGTTGCC AACTTTCTTG TACAAAGTGG TTGATATCGG TAAGCCTATC CCTAACCCTC 1381 TCCTCGGTCT CGATTCTACG TAGTAATGAA CTAGTCCGTA ACTTGAAAGT ATTTCGATTT 1441 CTTGGCTTTA TATATCTTGT GGAAAGGACG ATGTTAACAG TCACGTCTTA CTGTCACGCG 1501 TTAAGTCgac aatcaacctc tggattacaa aatttgtgaa agatt