Transcript: Human XM_011536159.2

PREDICTED: Homo sapiens G protein-coupled receptor 63 (GPR63), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GPR63 (81491)
Length:
5972
CDS:
366..1625

Additional Resources:

NCBI RefSeq record:
XM_011536159.2
NBCI Gene record:
GPR63 (81491)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011536159.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000011636 CCCTGGTAACTATTCTTACTA pLKO.1 778 CDS 100% 5.625 7.875 N GPR63 n/a
2 TRCN0000357307 ATAGCTACCCTGAAGGTATAT pLKO_005 1195 CDS 100% 13.200 10.560 N GPR63 n/a
3 TRCN0000357250 ATCACCCTTTCTGCTATAATG pLKO_005 609 CDS 100% 13.200 9.240 N GPR63 n/a
4 TRCN0000357251 CACGTGCCTTCACCACTATTT pLKO_005 1294 CDS 100% 13.200 9.240 N GPR63 n/a
5 TRCN0000011635 CCTCCAGGGTTCAATAGAAAT pLKO.1 1817 3UTR 100% 13.200 9.240 N GPR63 n/a
6 TRCN0000011637 CGGGACATCCAACACAACATT pLKO.1 401 CDS 100% 5.625 3.938 N GPR63 n/a
7 TRCN0000011638 CCTGGTAATACTGTACTCATT pLKO.1 1130 CDS 100% 4.950 3.465 N GPR63 n/a
8 TRCN0000011639 GCTGATCTACTACTGGAGGAT pLKO.1 1469 CDS 100% 2.640 1.848 N GPR63 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011536159.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489283 TCAGCCCCCGCTATGCCTTCAGGA pLX_317 30.7% 100% 100% V5 (not translated due to prior stop codon) n/a
2 TRCN0000487940 ATCCTTGTCAGTATTAGCAAACAC pLX_317 25.9% 99.9% 99.7% V5 1257_1258insG n/a
3 ccsbBroadEn_09064 pDONR223 100% 99.9% 100% None 42A>T n/a
4 ccsbBroad304_09064 pLX_304 0% 99.9% 100% V5 42A>T n/a
5 TRCN0000478023 TGTTAACAGTCACGTCTTACTGTC pLX_317 15.9% 99.9% 100% V5 42A>T n/a
Download CSV