Transcript: Mouse XM_006538382.3

PREDICTED: Mus musculus G protein-coupled receptor 63 (Gpr63), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gpr63 (81006)
Length:
2185
CDS:
234..1511

Additional Resources:

NCBI RefSeq record:
XM_006538382.3
NBCI Gene record:
Gpr63 (81006)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006538382.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000028003 CGACGTTTGTAGTCTTTGAAA pLKO.1 301 CDS 100% 5.625 7.875 N Gpr63 n/a
2 TRCN0000027969 CTGATATACTACTGGAGGATT pLKO.1 1356 CDS 100% 4.950 6.930 N Gpr63 n/a
3 TRCN0000028029 CCAGATGGATATTTGGGAAAT pLKO.1 685 CDS 100% 10.800 7.560 N Gpr63 n/a
4 TRCN0000027946 CGCTACCATTTCAGCATCCTA pLKO.1 346 CDS 100% 3.000 2.100 N Gpr63 n/a
5 TRCN0000028002 GCCCAAGTCTTTCAAGTTCTT pLKO.1 1409 CDS 100% 4.950 2.970 N Gpr63 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006538382.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489283 TCAGCCCCCGCTATGCCTTCAGGA pLX_317 30.7% 86.3% 91% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000487940 ATCCTTGTCAGTATTAGCAAACAC pLX_317 25.9% 86.2% 90.8% V5 (many diffs) n/a
3 ccsbBroadEn_09064 pDONR223 100% 86.2% 91% None (many diffs) n/a
4 ccsbBroad304_09064 pLX_304 0% 86.2% 91% V5 (many diffs) n/a
5 TRCN0000478023 TGTTAACAGTCACGTCTTACTGTC pLX_317 15.9% 86.2% 91% V5 (many diffs) n/a
Download CSV