Construct: ORF TRCN0000478057
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF009617.1_s317c1
- Derived from:
- ccsbBroadEn_09813
- DNA Barcode:
- AGAATACGCAAAACTTCCCATCCA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SLC16A13 (201232)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000478057
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 201232 | SLC16A13 | solute carrier family 16 me... | NM_201566.3 | 99.8% | 99.7% | 5C>T;1266G>A |
| 2 | mouse | 69309 | Slc16a13 | solute carrier family 16 (m... | NM_172371.3 | 87.8% | 87.1% | (many diffs) |
| 3 | mouse | 69309 | Slc16a13 | solute carrier family 16 (m... | XM_006534113.3 | 77.4% | 76.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1347
- ORF length:
- 1278
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggtgcgcagg acagagcccc ccgacggggg ctggggatgg gtggtggtgc 121 tctcagcgtt cttccagtcg gcgcttgtgt ttggggtgct ccgctccttt ggggtcttct 181 tcgtggagtt tgtggcggcg tttgaggagc aggcagcgcg cgtctcctgg atcgcctcca 241 taggaatcgc ggtgcagcag tttgggagcc cggtaggcag tgccctgagc acgaagttcg 301 ggcccaggcc cgtggtgatg actggaggca tcttggctgc gctggggatg ctgctcgcct 361 cttttgctac ttccttgacc cacctatacc tgagtattgg gttgctgtca ggctctggct 421 gggctttgac cttcgctccg accctggcct gcctgtcctg ttatttctct cgccgacgat 481 ccctggccac cgggctggca ctgacaggcg tgggcctctc ctccttcaca tttgccccct 541 ttttccagtg gctgctcagc cactacgcct ggagggggtc cctgctgctg gtgtctgccc 601 tctccctcca cctagtggcc tgtggtgctc tcctccgccc accctccctg gctgaggacc 661 ctgctgtggg tggtcccagg gcccaactca cctctctcct ccatcatggc cccttcctcc 721 gttacactgt tgccctcacc ctgatcaaca ctggctactt cattccctac ctccacctgg 781 tggcccatct ccaggacctg gattgggacc cactacctgc tgccttccta ctctcagttg 841 ttgctatttc tgacctcgtg gggcgtgtgg tctccggatg gctgggagat gcagtcccag 901 ggcctgtgac acgactcctg atgctctgga ccaccttgac tggggtgtca ctagccctgt 961 tccctgtagc tcaggctccc acagccctgg tggctctggc tgtggcctac ggcttcacat 1021 caggggctct ggccccactg gccttctccg tgctgcctga actaataggg actagaagga 1081 tttactgtgg cctgggactg ttgcagatga tagagagcat cggggggctg ctggggcctc 1141 ctctctcagg ctacctccgg gatgtgacag gcaactacac ggcttctttt gtggtggctg 1201 gggccttcct tctttcaggg agtggcattc tcctcaccct gccccacttc TTCTGCTTCT 1261 CAACTACTAC CTCCGGGCCC CAGGACCTTG TAACAGAAGC ACTAGATACT AAAGTTCCCC 1321 TACCCAAGGA GGGACTGGAA GAGGACTTGC CAACTTTCTT GTACAAAGTG GTTGATATCG 1381 GTAAGCCTAT CCCTAACCCT CTCCTCGGTC TCGATTCTAC GTAGTAATGA ACTAGTCCGT 1441 AACTTGAAAG TATTTCGATT TCTTGGCTTT ATATATCTTG TGGAAAGGAC GAAGAATACG 1501 CAAAACTTCC CATCCAACGC GTTAAGTCga caatcaacct ctggattaca aaatttgtga 1561 aagatt