Transcript: Human NM_201566.3

Homo sapiens solute carrier family 16 member 13 (SLC16A13), mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
SLC16A13 (201232)
Length:
1804
CDS:
369..1649

Additional Resources:

NCBI RefSeq record:
NM_201566.3
NBCI Gene record:
SLC16A13 (201232)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_201566.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000079612 AGGCAACTACACGGCTTCTTT pLKO.1 1469 CDS 100% 5.625 7.875 N Slc16a13 n/a
2 TRCN0000038628 CTGAACTAATAGGGACTAGAA pLKO.1 1357 CDS 100% 4.950 6.930 N SLC16A13 n/a
3 TRCN0000422026 TTATTTCTCTCGCCGACGATC pLKO_005 761 CDS 100% 4.050 5.670 N SLC16A13 n/a
4 TRCN0000419635 GAATCGCGGTGCAGCAGTTTG pLKO_005 544 CDS 100% 3.600 5.040 N SLC16A13 n/a
5 TRCN0000429233 GGACTGTTGCAGATGATAGAG pLKO_005 1395 CDS 100% 4.950 3.960 N SLC16A13 n/a
6 TRCN0000413359 ACAGAAGCACTAGATACTAAA pLKO_005 1593 CDS 100% 13.200 9.240 N SLC16A13 n/a
7 TRCN0000079611 ACCCACCTATACCTGAGTATT pLKO.1 678 CDS 100% 13.200 9.240 N Slc16a13 n/a
8 TRCN0000440229 GCCTCTCCTCCTTCACATTTG pLKO_005 814 CDS 100% 10.800 7.560 N SLC16A13 n/a
9 TRCN0000439488 GGGTCTTCTTCGTGGAGTTTG pLKO_005 472 CDS 100% 10.800 7.560 N SLC16A13 n/a
10 TRCN0000038626 CCTGATCAACACTGGCTACTT pLKO.1 1040 CDS 100% 4.950 3.465 N SLC16A13 n/a
11 TRCN0000038625 GACCCACCTATACCTGAGTAT pLKO.1 677 CDS 100% 4.950 3.465 N SLC16A13 n/a
12 TRCN0000038624 GCCTTCCTACTCTCAGTTGTT pLKO.1 1122 CDS 100% 4.950 3.465 N SLC16A13 n/a
13 TRCN0000038627 CCGGGATGTGACAGGCAACTA pLKO.1 1457 CDS 100% 1.650 1.155 N SLC16A13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_201566.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09813 pDONR223 100% 99.8% 99.7% None 5C>T;1266G>A n/a
2 ccsbBroad304_09813 pLX_304 0% 99.8% 99.7% V5 5C>T;1266G>A n/a
3 TRCN0000478057 AGAATACGCAAAACTTCCCATCCA pLX_317 8.2% 99.8% 99.7% V5 5C>T;1266G>A n/a
Download CSV