Transcript: Mouse XM_006534113.3

PREDICTED: Mus musculus solute carrier family 16 (monocarboxylic acid transporters), member 13 (Slc16a13), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Slc16a13 (69309)
Length:
3817
CDS:
1748..2890

Additional Resources:

NCBI RefSeq record:
XM_006534113.3
NBCI Gene record:
Slc16a13 (69309)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006534113.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000079612 AGGCAACTACACGGCTTCTTT pLKO.1 2704 CDS 100% 5.625 4.500 N Slc16a13 n/a
2 TRCN0000079608 CCCTTGTATATCAAACAAGTA pLKO.1 3190 3UTR 100% 0.495 0.396 N Slc16a13 n/a
3 TRCN0000079610 CTTGTGATAGAGGCATCAGAT pLKO.1 2825 CDS 100% 4.950 3.465 N Slc16a13 n/a
4 TRCN0000038627 CCGGGATGTGACAGGCAACTA pLKO.1 2692 CDS 100% 1.650 1.155 N SLC16A13 n/a
5 TRCN0000079609 CGGTGTCTTCTTCGTGGAATT pLKO.1 1849 CDS 100% 0.000 0.000 N Slc16a13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006534113.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09813 pDONR223 100% 77.4% 76.4% None (many diffs) n/a
2 ccsbBroad304_09813 pLX_304 0% 77.4% 76.4% V5 (many diffs) n/a
3 TRCN0000478057 AGAATACGCAAAACTTCCCATCCA pLX_317 8.2% 77.4% 76.4% V5 (many diffs) n/a
Download CSV