Construct: ORF TRCN0000478065
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF006509.1_s317c1
- Derived from:
- ccsbBroadEn_06246
- DNA Barcode:
- TTAATCTACTGCCGCTTGACGACA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- GABRG2 (2566)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000478065
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 2566 | GABRG2 | gamma-aminobutyric acid typ... | NM_000816.3 | 99.9% | 100% | 588C>T |
2 | human | 2566 | GABRG2 | gamma-aminobutyric acid typ... | NM_198904.3 | 98.2% | 98.3% | 588C>T;1129_1152del |
3 | human | 2566 | GABRG2 | gamma-aminobutyric acid typ... | NM_198903.2 | 90.6% | 90.4% | 588C>T;632_751del;1249_1272del |
4 | mouse | 14406 | Gabrg2 | gamma-aminobutyric acid (GA... | NM_177408.6 | 90.7% | 99.1% | (many diffs) |
5 | mouse | 14406 | Gabrg2 | gamma-aminobutyric acid (GA... | NM_008073.3 | 89.2% | 97.4% | (many diffs) |
6 | mouse | 14406 | Gabrg2 | gamma-aminobutyric acid (GA... | XM_006532199.1 | 85.5% | 93.6% | (many diffs) |
7 | mouse | 14406 | Gabrg2 | gamma-aminobutyric acid (GA... | XM_006532200.2 | 85.4% | 93.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1470
- ORF length:
- 1401
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gagttcgcca aatatatgga gcacaggaag ctcagtctac tcgactcctg 121 tattttcaca gaaaatgacg gtgtggattc tgctcctgct gtcgctctac cctggcttca 181 ctagccagaa atctgatgat gactatgaag attatgcttc taacaaaaca tgggtcttga 241 ctccaaaagt tcctgagggt gatgtcactg tcatcttaaa caacctgctg gaaggatatg 301 acaataaact tcggcctgat ataggagtga agccaacgtt aattcacaca gacatgtatg 361 tgaatagcat tggtccagtg aacgctatca atatggaata cactattgat atattttttg 421 cgcaaacgtg gtatgacaga cgtttgaaat ttaacagcac cattaaagtc ctccgattga 481 acagcaacat ggtggggaaa atctggattc cagacacttt cttcagaaat tccaaaaaag 541 ctgatgcaca ctggatcacc acccccaaca ggatgctgag aatttggaat gatggtcgag 601 tgctctacac cctaaggttg acaattgatg ctgagtgcca attacaattg cacaattttc 661 caatggatga acactcctgc cccttggagt tctccagtta tggctatcca cgtgaagaaa 721 ttgtttatca atggaagcga agttctgttg aagtgggcga cacaagatcc tggaggcttt 781 atcaattctc atttgttggt ctaagaaata ccaccgaagt agtgaagaca acttccggag 841 attatgtggt catgtctgtc tactttgatc tgagcagaag aatgggatac tttaccatcc 901 agacctatat cccctgcaca ctcattgtcg tcctatcctg ggtgtctttc tggatcaata 961 aggatgctgt tccagccaga acatctttag gtatcaccac tgtcctgaca atgaccaccc 1021 tcagcaccat tgcccggaaa tcgctcccca aggtctccta tgtcacagcg atggatctct 1081 ttgtatctgt ttgtttcatc tttgtcttct ctgctctggt ggagtatggc accttgcatt 1141 attttgtcag caaccggaaa ccaagcaagg acaaagataa aaagaagaaa aaccctgccc 1201 cTACCATTGA TATCCGCCCA AGATCAGCAA CCATTCAAAT GAATAATGCT ACACACCTTC 1261 AAGAGAGAGA TGAAGAGTAC GGCTATGAGT GTCTGGACGG CAAGGACTGT GCCAGTTTTT 1321 TCTGCTGTTT TGAAGATTGT CGAACAGGAG CTTGGAGACA TGGGAGGATA CATATCCGCA 1381 TTGCCAAAAT GGACTCCTAT GCTCGGATCT TCTTCCCCAC TGCCTTCTGC CTGTTTAATC 1441 TGGTCTATTG GGTCTCCTAC CTCTACCTGT TGCCAACTTT CTTGTACAAA GTGGTTGATA 1501 TCGGTAAGCC TATCCCTAAC CCTCTCCTCG GTCTCGATTC TACGTAGTAA TGAACTAGTC 1561 CGTAACTTGA AAGTATTTCG ATTTCTTGGC TTTATATATC TTGTGGAAAG GACGATTAAT 1621 CTACTGCCGC TTGACGACAA CGCGTTAAGT Cgacaatcaa cctctggatt acaaaatttg 1681 tgaaagatt