Transcript: Human NM_198904.3

Homo sapiens gamma-aminobutyric acid type A receptor gamma2 subunit (GABRG2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
GABRG2 (2566)
Length:
4121
CDS:
536..1963

Additional Resources:

NCBI RefSeq record:
NM_198904.3
NBCI Gene record:
GABRG2 (2566)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_198904.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000413219 CTATGTCCAAACCTGGTAAAT pLKO_005 2078 3UTR 100% 13.200 18.480 N GABRG2 n/a
2 TRCN0000048248 GCCTGTTTAATCTGGTCTATT pLKO.1 1920 CDS 100% 13.200 18.480 N GABRG2 n/a
3 TRCN0000435870 GTATCCTTACTAGATTCATAA pLKO_005 2281 3UTR 100% 13.200 18.480 N GABRG2 n/a
4 TRCN0000048252 CCACCGAAGTAGTGAAGACAA pLKO.1 1278 CDS 100% 4.950 6.930 N GABRG2 n/a
5 TRCN0000048250 CCTCCGATTGAACAGCAACAT pLKO.1 937 CDS 100% 4.950 6.930 N GABRG2 n/a
6 TRCN0000048249 GCACACTCATTGTCGTCCTAT pLKO.1 1383 CDS 100% 4.950 6.930 N GABRG2 n/a
7 TRCN0000429887 GGAGTGAAGCCAACGTTAATT pLKO_005 791 CDS 100% 15.000 12.000 N GABRG2 n/a
8 TRCN0000434007 GAGACATGGGAGGATACATAT pLKO_005 1846 CDS 100% 13.200 9.240 N GABRG2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_198904.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06246 pDONR223 100% 98.2% 98.3% None 588C>T;1129_1152del n/a
2 ccsbBroad304_06246 pLX_304 0% 98.2% 98.3% V5 588C>T;1129_1152del n/a
3 TRCN0000478065 TTAATCTACTGCCGCTTGACGACA pLX_317 19.5% 98.2% 98.3% V5 588C>T;1129_1152del n/a
Download CSV