Construct: ORF TRCN0000478080
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF005566.1_s317c1
- Derived from:
- ccsbBroadEn_07950
- DNA Barcode:
- ATCACGGAGTTCACCACTCCAACA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- RAB26 (25837)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000478080
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 25837 | RAB26 | RAB26, member RAS oncogene ... | NM_014353.5 | 99.8% | 99.6% | 680A>G |
2 | human | 25837 | RAB26 | RAB26, member RAS oncogene ... | XM_011522448.1 | 82.6% | 79.7% | 590_621del;693_694ins107 |
3 | human | 25837 | RAB26 | RAB26, member RAS oncogene ... | NM_001308053.1 | 74% | 73.8% | 0_1ins198;482A>G |
4 | human | 25837 | RAB26 | RAB26, member RAS oncogene ... | XM_011522450.2 | 54.5% | 54.2% | 0_1ins348;332A>G |
5 | mouse | 328778 | Rab26 | RAB26, member RAS oncogene ... | NM_177375.1 | 83.2% | 85.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 834
- ORF length:
- 768
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtc caggaagaag acccccaaga gcaaaggggc cagcaccccc gctgcctcca 121 cgctgcccac cgccaacggg gcccgaccgg cgcgctccgg gactgcgctt tccggccccg 181 acgcgccgcc caacgggccc ttgcagcccg gccggccctc gcttggcggc ggtgtcgact 241 tctacgacgt cgccttcaag gtcatgctgg tgggggactc gggtgtgggg aagacctgtc 301 tgctggtgcg attcaaggat ggtgctttcc tggcggggac cttcatctcc accgtaggca 361 ttgacttccg gaacaaagtt ctggacgtgg atggtgtgaa ggtgaagctg cagatgtggg 421 acacagctgg tcaggagcgg ttccgcagtg ttacccatgc ctactaccgg gatgctcatg 481 ctctgctgct gctctacgat gtcaccaaca aggcctcctt tgacaacatc caggcctggc 541 tgaccgagat ccacgagtac gcccagcacg acgtggcgct catgctgcTG GGGAACAAGG 601 TGGACTCTGC CCATGAGCGT GTGGTGAAGA GGGAGGACGG GGAGAAGCTG GCCAAGGAGT 661 ATGGACTGCC CTTCATGGAG ACCAGCGCCA AGACGGGCCT CAACGTGGAC TTGGCCTTCA 721 CAGCCATAGC AAAGGAGTTG AAGCGGCGCT CCATGAAGGC TCCCAGCGAG CCGCGCTTCC 781 GGCTGCATGA TTACGTTAAG AGGGAGGGTC GAGGGGCCTC CTGCTGCCGC CCTTGCCCAA 841 CTTTCTTGTA CAAAGTGGTT GATATCGGTA AGCCTATCCC TAACCCTCTC CTCGGTCTCG 901 ATTCTACGTA GTAATGAACT AGTCCGTAAC TTGAAAGTAT TTCGATTTCT TGGCTTTATA 961 TATCTTGTGG AAAGGACGAA TCACGGAGTT CACCACTCCA ACAACGCGTT AAGTCgacaa 1021 tcaacctctg gattacaaaa tttgtgaaag att