Transcript: Mouse NM_177375.1

Mus musculus RAB26, member RAS oncogene family (Rab26), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Rab26 (328778)
Length:
1434
CDS:
165..947

Additional Resources:

NCBI RefSeq record:
NM_177375.1
NBCI Gene record:
Rab26 (328778)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177375.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000341481 GGCATCGACTTCCGGAATAAA pLKO_005 468 CDS 100% 15.000 10.500 N Rab26 n/a
2 TRCN0000341411 CAGGCTGCATGACTATGTTAA pLKO_005 890 CDS 100% 13.200 9.240 N Rab26 n/a
3 TRCN0000341409 TGAGAATTGCCCGAGTCTATA pLKO_005 994 3UTR 100% 13.200 9.240 N Rab26 n/a
4 TRCN0000341413 ACTCAAGACCGTGTGGTAAAG pLKO_005 720 CDS 100% 10.800 7.560 N Rab26 n/a
5 TRCN0000341412 TCTACGACATCACCAACAAAG pLKO_005 604 CDS 100% 10.800 7.560 N Rab26 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177375.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07950 pDONR223 100% 83.2% 85.3% None (many diffs) n/a
2 ccsbBroad304_07950 pLX_304 0% 83.2% 85.3% V5 (many diffs) n/a
3 TRCN0000478080 ATCACGGAGTTCACCACTCCAACA pLX_317 32.4% 83.2% 85.3% V5 (many diffs) n/a
Download CSV